Construct: ORF TRCN0000469627
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002302.1_s317c1
- Derived from:
- ccsbBroadEn_06819
- DNA Barcode:
- AGCTCTCGAACTTTAGACCTGATA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PTPRR (5801)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469627
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 5801 | PTPRR | protein tyrosine phosphatas... | NM_130846.3 | 99.8% | 99.5% | 10T>C;268G>A |
2 | human | 5801 | PTPRR | protein tyrosine phosphatas... | NM_001207016.1 | 91.2% | 90.9% | 1_117del;127T>C;385G>A |
3 | human | 5801 | PTPRR | protein tyrosine phosphatas... | NM_001207015.2 | 75.4% | 75.2% | 1_399del;409T>C;667G>A |
4 | human | 5801 | PTPRR | protein tyrosine phosphatas... | XM_011538615.2 | 63.3% | 63.1% | 1_711del;721T>C;979G>A |
5 | human | 5801 | PTPRR | protein tyrosine phosphatas... | NM_002849.4 | 62.6% | 62.4% | 1_735del;745T>C;1003G>A |
6 | human | 5801 | PTPRR | protein tyrosine phosphatas... | XR_001748831.2 | 41.4% | (many diffs) | |
7 | human | 5801 | PTPRR | protein tyrosine phosphatas... | XR_001748830.1 | 35% | (many diffs) | |
8 | mouse | 19279 | Ptprr | protein tyrosine phosphatas... | NM_001161838.1 | 87.5% | 91.7% | (many diffs) |
9 | mouse | 19279 | Ptprr | protein tyrosine phosphatas... | NM_001161839.1 | 87.5% | 91.7% | (many diffs) |
10 | mouse | 19279 | Ptprr | protein tyrosine phosphatas... | NM_001161840.1 | 87.5% | 91.7% | (many diffs) |
11 | mouse | 19279 | Ptprr | protein tyrosine phosphatas... | XM_006513383.3 | 67.4% | 70.6% | (many diffs) |
12 | mouse | 19279 | Ptprr | protein tyrosine phosphatas... | NM_001161837.1 | 65.7% | 68.8% | (many diffs) |
13 | mouse | 19279 | Ptprr | protein tyrosine phosphatas... | XM_006513382.1 | 58.2% | 60.9% | (many diffs) |
14 | mouse | 19279 | Ptprr | protein tyrosine phosphatas... | NM_011217.2 | 55% | 57.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1305
- ORF length:
- 1236
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gattcttcac agattaaaag aaagatttca gctttcctta agacaagaca 121 aagagaaaaa ccaggagatc cacctatcgc ccatcacatt acagccagca ctgtccgagg 181 caaagacagt ccacagcatg gtccaacctg agcaggcccc aaaggtactg aatgttgtcg 241 tggaccctca aggccgaggt gctcctgaga tcaaagctac caccgctacc tctgtttgcc 301 cttctccttt caaaatgaag cccataggac ttcaaaagag aagagggtcc aacgtatctc 361 ttacattgga catgagtagc ttggggaaca ttgaaccctt tgtgtctata ccaacaccac 421 gggagaaggt agcaatggag tatctgcagt cagccagccg aattctcaca aggtctcagc 481 tgagggacgt cgtggcaagt tcacatttac tccaaagtga attcatggaa ataccaatga 541 actttgtgga tcccaaagaa attgatattc cgcgtcatgg aactaaaaat cgctataaga 601 ccattttacc aaatcccctc agcagagtgt gtttaagacc aaaaaatgta accgattcat 661 tgagcaccta cattaatgct aattatatta ggggctacag tggcaaggag aaagccttca 721 ttgccacgca gggccccatg atcaacaccg tggatgattt ctggcagatg gtttggcagg 781 aagacagccc tgtgattgtt atgatcacaa aactcaaaga aaaaaatgag aaatgtgtgc 841 tatactggcc ggaaaagaga gggatatatg gaaaagttGA GGTTCTGGTT ATCAGTGTAA 901 ATGAATGTGA TAACTACACC ATTCGAAACC TTGTCTTAAA GCAAGGAAGC CACACCCAAC 961 ATGTGAAGCA TTACTGGTAC ACCTCATGGC CTGATCACAA GACTCCAGAC AGTGCCCAGC 1021 CCCTCCTACA GCTCATGCTG GATGTAGAAG AAGACAGACT TGCTTCCCAG GGCCGAGGGC 1081 CTGTGGTTGT CCACTGCAGT GCAGGAATAG GTAGAACAGG GTGTTTTATT GCTACATCCA 1141 TTGGCTGTCA ACAGCTGAAA GAAGAAGGAG TTGTGGATGC ACTAAGCATT GTCTGCCAGC 1201 TTCGTATGGA TAGAGGTGGA ATGGTGCAAA CCAGTGAGCA GTATGAATTT GTGCACCATG 1261 CTCTGTGCCT GTATGAGAGC AGACTTTCAG CAGAGACTGT CCAGTTGCCA ACTTTCTTGT 1321 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1381 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1441 GAAAGGACGA AGCTCTCGAA CTTTAGACCT GATAACGCGT TAAGTCgaca atcaacctct 1501 ggattacaaa atttgtgaaa gatt