Transcript: Mouse NM_001161837.1

Mus musculus protein tyrosine phosphatase, receptor type, R (Ptprr), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Ptprr (19279)
Length:
2860
CDS:
108..1757

Additional Resources:

NCBI RefSeq record:
NM_001161837.1
NBCI Gene record:
Ptprr (19279)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001161837.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000445401 GTCGAGTGACTCCGAAGATTT pLKO_005 1749 CDS 100% 13.200 18.480 N Ptprr n/a
2 TRCN0000220475 CGAGGTTCCAATGTATCTCTT pLKO.1 792 CDS 100% 4.950 6.930 N Ptprr n/a
3 TRCN0000220473 CCCACCTACTTCAAAGTGAAT pLKO.1 952 CDS 100% 4.950 3.960 N Ptprr n/a
4 TRCN0000220476 GCTTTCCTTAAGACAAGATAA pLKO.1 551 CDS 100% 13.200 9.240 N Ptprr n/a
5 TRCN0000452851 GTTGTAGACGCACTAAGTATT pLKO_005 1620 CDS 100% 13.200 9.240 N Ptprr n/a
6 TRCN0000449756 ACCGATTCCTTGAGTACTTAC pLKO_005 1101 CDS 100% 10.800 7.560 N Ptprr n/a
7 TRCN0000220474 GCTACATCCATTGGCTGTCAA pLKO.1 1581 CDS 100% 4.950 3.465 N Ptprr n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001161837.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01346 pDONR223 100% 65.7% 69.3% None (many diffs) n/a
2 ccsbBroad304_01346 pLX_304 0% 65.7% 69.3% V5 (many diffs) n/a
3 TRCN0000476415 AACAATTCCGACCGCCCCAGAATA pLX_317 22.9% 65.7% 69.3% V5 (many diffs) n/a
4 ccsbBroadEn_06819 pDONR223 100% 65.7% 68.8% None (many diffs) n/a
5 ccsbBroad304_06819 pLX_304 0% 65.7% 68.8% V5 (many diffs) n/a
6 TRCN0000469627 AGCTCTCGAACTTTAGACCTGATA pLX_317 34.7% 65.7% 68.8% V5 (many diffs) n/a
Download CSV