Transcript: Human NM_001207016.1

Homo sapiens protein tyrosine phosphatase receptor type R (PTPRR), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
PTPRR (5801)
Length:
2650
CDS:
167..1522

Additional Resources:

NCBI RefSeq record:
NM_001207016.1
NBCI Gene record:
PTPRR (5801)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001207016.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220474 GCTACATCCATTGGCTGTCAA pLKO.1 1346 CDS 100% 4.950 6.930 N Ptprr n/a
2 TRCN0000010746 CGTGGATGATTTCTGGCAGAT pLKO.1 964 CDS 100% 4.050 3.240 N PTPRR n/a
3 TRCN0000355625 TGCTGAAGACATTCGTATTAT pLKO_005 1879 3UTR 100% 15.000 10.500 N PTPRR n/a
4 TRCN0000355566 ATGGAGGTATGATAGGTTTAT pLKO_005 1748 3UTR 100% 13.200 9.240 N PTPRR n/a
5 TRCN0000355565 TTCATTGAGCACCTACATTAA pLKO_005 871 CDS 100% 13.200 9.240 N PTPRR n/a
6 TRCN0000002908 CTGGGCAACATATTTAAGATT pLKO.1 1660 3UTR 100% 5.625 3.938 N PTPRR n/a
7 TRCN0000002906 TCAAGAGAGAAGAGGGTCCAA pLKO.1 547 CDS 100% 2.640 1.848 N PTPRR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001207016.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01346 pDONR223 100% 91.2% 91.1% None 1_117del;323A>G n/a
2 ccsbBroad304_01346 pLX_304 0% 91.2% 91.1% V5 1_117del;323A>G n/a
3 TRCN0000476415 AACAATTCCGACCGCCCCAGAATA pLX_317 22.9% 91.2% 91.1% V5 1_117del;323A>G n/a
4 ccsbBroadEn_06819 pDONR223 100% 91.2% 90.9% None 1_117del;127T>C;385G>A n/a
5 ccsbBroad304_06819 pLX_304 0% 91.2% 90.9% V5 1_117del;127T>C;385G>A n/a
6 TRCN0000469627 AGCTCTCGAACTTTAGACCTGATA pLX_317 34.7% 91.2% 90.9% V5 1_117del;127T>C;385G>A n/a
Download CSV