Transcript: Mouse NM_001161839.1

Mus musculus protein tyrosine phosphatase, receptor type, R (Ptprr), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Ptprr (19279)
Length:
2508
CDS:
167..1405

Additional Resources:

NCBI RefSeq record:
NM_001161839.1
NBCI Gene record:
Ptprr (19279)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001161839.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000445401 GTCGAGTGACTCCGAAGATTT pLKO_005 1397 CDS 100% 13.200 18.480 N Ptprr n/a
2 TRCN0000220475 CGAGGTTCCAATGTATCTCTT pLKO.1 440 CDS 100% 4.950 6.930 N Ptprr n/a
3 TRCN0000220473 CCCACCTACTTCAAAGTGAAT pLKO.1 600 CDS 100% 4.950 3.960 N Ptprr n/a
4 TRCN0000220476 GCTTTCCTTAAGACAAGATAA pLKO.1 199 CDS 100% 13.200 9.240 N Ptprr n/a
5 TRCN0000452851 GTTGTAGACGCACTAAGTATT pLKO_005 1268 CDS 100% 13.200 9.240 N Ptprr n/a
6 TRCN0000449756 ACCGATTCCTTGAGTACTTAC pLKO_005 749 CDS 100% 10.800 7.560 N Ptprr n/a
7 TRCN0000220474 GCTACATCCATTGGCTGTCAA pLKO.1 1229 CDS 100% 4.950 3.465 N Ptprr n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001161839.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01346 pDONR223 100% 87.5% 92.4% None (many diffs) n/a
2 ccsbBroad304_01346 pLX_304 0% 87.5% 92.4% V5 (many diffs) n/a
3 TRCN0000476415 AACAATTCCGACCGCCCCAGAATA pLX_317 22.9% 87.5% 92.4% V5 (many diffs) n/a
4 ccsbBroadEn_06819 pDONR223 100% 87.5% 91.7% None (many diffs) n/a
5 ccsbBroad304_06819 pLX_304 0% 87.5% 91.7% V5 (many diffs) n/a
6 TRCN0000469627 AGCTCTCGAACTTTAGACCTGATA pLX_317 34.7% 87.5% 91.7% V5 (many diffs) n/a
Download CSV