Construct: ORF TRCN0000469854
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008603.1_s317c1
- Derived from:
- ccsbBroadEn_10875
- DNA Barcode:
- ACACCGAACACAATGTCGCAAGTA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- HLA-C (3107)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469854
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3107 | HLA-C | major histocompatibility co... | NM_001243042.1 | 93.9% | 89.5% | (many diffs) |
| 2 | human | 3107 | HLA-C | major histocompatibility co... | NM_002117.6 | 93.9% | 89.5% | (many diffs) |
| 3 | human | 3106 | HLA-B | major histocompatibility co... | NM_005514.8 | 90.9% | 86.5% | (many diffs) |
| 4 | human | 3105 | HLA-A | major histocompatibility co... | NM_002116.8 | 87.8% | 82.7% | (many diffs) |
| 5 | human | 3105 | HLA-A | major histocompatibility co... | NM_001242758.1 | 87.3% | 80.6% | (many diffs) |
| 6 | human | 3133 | HLA-E | major histocompatibility co... | NM_005516.6 | 83.2% | 72.8% | (many diffs) |
| 7 | human | 3133 | HLA-E | major histocompatibility co... | XM_017010809.2 | 81.9% | 69.7% | (many diffs) |
| 8 | human | 3135 | HLA-G | major histocompatibility co... | NM_002127.5 | 80.8% | 74.1% | (many diffs) |
| 9 | human | 3135 | HLA-G | major histocompatibility co... | XM_024446420.1 | 80.8% | 74.1% | (many diffs) |
| 10 | human | 3134 | HLA-F | major histocompatibility co... | NM_018950.2 | 80.3% | 73.3% | (many diffs) |
| 11 | human | 3135 | HLA-G | major histocompatibility co... | NM_001363567.1 | 79.8% | 73.2% | (many diffs) |
| 12 | human | 3134 | HLA-F | major histocompatibility co... | XM_011514564.1 | 79.2% | 72.5% | (many diffs) |
| 13 | human | 3134 | HLA-F | major histocompatibility co... | XM_017010813.1 | 77.1% | 68.7% | (many diffs) |
| 14 | human | 3133 | HLA-E | major histocompatibility co... | XM_017010807.1 | 74.2% | 60.1% | (many diffs) |
| 15 | human | 3133 | HLA-E | major histocompatibility co... | XM_017010808.1 | 74.2% | 60.1% | (many diffs) |
| 16 | human | 3134 | HLA-F | major histocompatibility co... | XM_017010811.1 | 71.7% | 59.2% | (many diffs) |
| 17 | human | 3134 | HLA-F | major histocompatibility co... | XM_017010812.1 | 71.4% | 63.6% | (many diffs) |
| 18 | human | 3134 | HLA-F | major histocompatibility co... | XM_017010810.1 | 69.1% | 61.5% | (many diffs) |
| 19 | human | 3134 | HLA-F | major histocompatibility co... | NM_001098479.2 | 68% | 60.5% | (many diffs) |
| 20 | human | 3135 | HLA-G | major histocompatibility co... | XM_017010817.1 | 59.3% | 54.5% | (many diffs) |
| 21 | human | 3135 | HLA-G | major histocompatibility co... | XM_017010818.1 | 59.3% | 54.5% | (many diffs) |
| 22 | human | 3134 | HLA-F | major histocompatibility co... | NM_001098478.2 | 58.3% | 51.3% | (many diffs) |
| 23 | human | 3136 | HLA-H | major histocompatibility co... | NR_001434.4 | 57% | (many diffs) | |
| 24 | human | 3134 | HLA-F | major histocompatibility co... | XM_017010815.1 | 53.5% | 49.4% | (many diffs) |
| 25 | human | 3134 | HLA-F | major histocompatibility co... | XM_017010814.1 | 46% | 40.9% | (many diffs) |
| 26 | human | 3134 | HLA-F | major histocompatibility co... | XR_001743373.1 | 28.8% | (many diffs) | |
| 27 | human | 3134 | HLA-F | major histocompatibility co... | XR_001743376.1 | 28% | (many diffs) | |
| 28 | human | 3134 | HLA-F | major histocompatibility co... | XR_001743374.1 | 27.7% | (many diffs) | |
| 29 | human | 3139 | HLA-L | major histocompatibility co... | NR_027822.1 | 16.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1182
- ORF length:
- 1116
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcg ggtgatggcg ccccgaaccc tcatcctgct gctctcggga gccctggccc 121 tgaccgagac ctgggccggc tcccactcca tgaggtattt ctacaccgct gtgtcccggc 181 ccggccgcgg ggagccccac ttcatcgcag tgggctacgt ggacgacacg cagttcgtgc 241 ggttcgacag cgacgccgcg agtccgagag gggagccgcg ggcgccgtgg gtggagcagg 301 aggggccgga gtattgggac cgggagacac agaagtacaa gcgccaggca cagactgacc 361 gagtgagcct gcggaacctg cgcggctact acaaccagag cgaggccagg tctcacatca 421 tccagaggat gtatggctgc gacgtggggc ccgacgggcg cctcctccgc gggtatgacc 481 agtacgccta cgacggcaag gattacatcg ccctgaacga ggatctgcgc tcctggaccg 541 ccgcggacac ggcggctcag atcacccagc gcaagtggga ggcggcccgt gaggcggagc 601 agctgagagc ctacctggag ggcctgtgcg tggagtggct ccgcagatac ctgaagaatg 661 ggaaggagac gctgcagcgc gcggaacacc caaagacaca cgtgacccac catcccgtct 721 ctgaccatga ggccaccctG AGGTGCTGGG CCCTGGGCTT CTACCCTGCG GAGATCACAC 781 TGACCTGGCA GTGGGATGGG GAGGACCAAA CTCAGGACAC TGAGCTTGTG GAGACCAGGC 841 CAGCAGGAGA TGGAACCTTC CAGAAGTGGG CAGCTGTGGT GGTGCCTTCT GGAGAAGAGC 901 AGAGATACAC GTGCCATGTG CAGCACGAGG GGCTGCCGGA GCCCCTCACC CTGAGATGGG 961 AGCCGTCTTC CCAGCCCACC ATCCCCATCG TGGGCATCGT TGCTGGCCTG GCTGTCCTGG 1021 CTGTCCTAGC TGTCCTAGGA GCTGTGGTGG CTGTTGTGAT GTGTAGGAGG AAGAGCTCAG 1081 GGCATTTTCT TCCCACAGGT GGAAAAGGAG GGAGCTGCTC TCAGGCTGCG TCCAGCAACA 1141 GTGCCCAGGG CTCTGATGAG TCTCTCATCG CTTGTAAAGC CTGCCCAACT TTCTTGTACA 1201 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1261 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1321 AGGACGAACA CCGAACACAA TGTCGCAAGT AACGCGTTAA GTCgacaatc aacctctgga 1381 ttacaaaatt tgtgaaagat t