Transcript: Mouse XM_017319977.2

PREDICTED: Mus musculus guanine nucleotide binding protein (G protein), beta 1 (Gnb1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Gnb1 (14688)
Length:
3155
CDS:
322..1344

Additional Resources:

NCBI RefSeq record:
XM_017319977.2
NBCI Gene record:
Gnb1 (14688)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319977.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034433 CCAAATTAGAGATGCTCGTAA pLKO.1 369 CDS 100% 4.950 6.930 N Gnb1 n/a
2 TRCN0000301619 CCAAATTAGAGATGCTCGTAA pLKO_005 369 CDS 100% 4.950 6.930 N Gnb1 n/a
3 TRCN0000034430 CGACTCTTTCTCAGATCACAA pLKO.1 404 CDS 100% 4.950 6.930 N Gnb1 n/a
4 TRCN0000301618 CGACTCTTTCTCAGATCACAA pLKO_005 404 CDS 100% 4.950 6.930 N Gnb1 n/a
5 TRCN0000034431 CCTACTCCCATGACAACATTA pLKO.1 1109 CDS 100% 13.200 9.240 N Gnb1 n/a
6 TRCN0000301616 CCTACTCCCATGACAACATTA pLKO_005 1109 CDS 100% 13.200 9.240 N Gnb1 n/a
7 TRCN0000034429 GCTGAAACCAAGAGCACAATT pLKO.1 1505 3UTR 100% 13.200 9.240 N Gnb1 n/a
8 TRCN0000301615 GCTGAAACCAAGAGCACAATT pLKO_005 1505 3UTR 100% 13.200 9.240 N Gnb1 n/a
9 TRCN0000034432 GCCAGCAGACAACCACATTTA pLKO.1 842 CDS 100% 13.200 7.920 N Gnb1 n/a
10 TRCN0000301617 GCCAGCAGACAACCACATTTA pLKO_005 842 CDS 100% 13.200 7.920 N Gnb1 n/a
11 TRCN0000036783 GCTTGTGATGCTTCAGCCAAA pLKO.1 928 CDS 100% 4.050 2.835 N GNB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319977.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00654 pDONR223 100% 90.1% 100% None (many diffs) n/a
2 ccsbBroad304_00654 pLX_304 0% 90.1% 100% V5 (many diffs) n/a
3 TRCN0000469902 TCTGGTCGCGCACGCAAGCGGTAA pLX_317 41.4% 90.1% 100% V5 (many diffs) n/a
4 ccsbBroadEn_06297 pDONR223 100% 77.1% 90.2% None (many diffs) n/a
5 ccsbBroad304_06297 pLX_304 0% 77.1% 90.2% V5 (many diffs) n/a
6 TRCN0000475025 GATTCCCGACGGCGCCTATTGAGT pLX_317 50.8% 77.1% 90.2% V5 (many diffs) n/a
7 ccsbBroadEn_00655 pDONR223 100% 77.1% 90.2% None (many diffs) n/a
8 ccsbBroad304_00655 pLX_304 0% 77.1% 90.2% V5 (many diffs) n/a
9 TRCN0000472058 GGGAACAATCACATTGATCACTTT pLX_317 45.7% 77.1% 90.2% V5 (many diffs) n/a
10 ccsbBroadEn_08785 pDONR223 100% 77.1% 90.5% None (many diffs) n/a
11 ccsbBroad304_08785 pLX_304 0% 77.1% 90.5% V5 (many diffs) n/a
12 TRCN0000470309 TTAATCACTAATCACTGTATTAGT pLX_317 39.7% 77.1% 90.5% V5 (many diffs) n/a
Download CSV