Transcript: Human NM_021629.4

Homo sapiens G protein subunit beta 4 (GNB4), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
GNB4 (59345)
Length:
6315
CDS:
168..1190

Additional Resources:

NCBI RefSeq record:
NM_021629.4
NBCI Gene record:
GNB4 (59345)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021629.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036918 GCTGGTTACGATGACTTTAAT pLKO.1 1026 CDS 100% 15.000 21.000 N GNB4 n/a
2 TRCN0000420318 TGGGATAGCTATACAACAAAT pLKO_005 411 CDS 100% 13.200 18.480 N GNB4 n/a
3 TRCN0000036917 GTCGAATACAAATGCGAACAA pLKO.1 289 CDS 100% 4.950 6.930 N GNB4 n/a
4 TRCN0000036914 GCCTCTTCCAAATTATGGGAT pLKO.1 783 CDS 100% 2.640 2.112 N GNB4 n/a
5 TRCN0000036916 CGTGCAGATCAAGAGTTATTA pLKO.1 933 CDS 100% 15.000 10.500 N GNB4 n/a
6 TRCN0000414869 ATGCTCCCTCTGGTAATTATG pLKO_005 481 CDS 100% 13.200 9.240 N GNB4 n/a
7 TRCN0000432517 TGTGAGCTGCTTAGGTGTAAC pLKO_005 1109 CDS 100% 10.800 7.560 N GNB4 n/a
8 TRCN0000036915 GCTCGGAAAGCATGTAATGAT pLKO.1 228 CDS 100% 5.625 3.938 N GNB4 n/a
9 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 4394 3UTR 100% 4.950 2.475 Y CFLAR n/a
10 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 4394 3UTR 100% 4.950 2.475 Y C19orf31 n/a
11 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 2959 3UTR 100% 4.050 2.025 Y P3H4 n/a
12 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 2959 3UTR 100% 4.050 2.025 Y ORAI2 n/a
13 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 2959 3UTR 100% 4.050 2.025 Y P3H4 n/a
14 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4128 3UTR 100% 5.625 2.813 Y KLHL30 n/a
15 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 4392 3UTR 100% 4.950 2.475 Y ERN2 n/a
16 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 4392 3UTR 100% 4.950 2.475 Y P3H4 n/a
17 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 4392 3UTR 100% 4.950 2.475 Y P3H4 n/a
18 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4128 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021629.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08785 pDONR223 100% 99.8% 99.7% None 11T>C;117T>C n/a
2 ccsbBroad304_08785 pLX_304 0% 99.8% 99.7% V5 11T>C;117T>C n/a
3 TRCN0000470309 TTAATCACTAATCACTGTATTAGT pLX_317 39.7% 99.8% 99.7% V5 11T>C;117T>C n/a
4 ccsbBroadEn_00654 pDONR223 100% 75.9% 90.8% None (many diffs) n/a
5 ccsbBroad304_00654 pLX_304 0% 75.9% 90.8% V5 (many diffs) n/a
6 TRCN0000469902 TCTGGTCGCGCACGCAAGCGGTAA pLX_317 41.4% 75.9% 90.8% V5 (many diffs) n/a
7 ccsbBroadEn_06297 pDONR223 100% 71.7% 90% None (many diffs) n/a
8 ccsbBroad304_06297 pLX_304 0% 71.7% 90% V5 (many diffs) n/a
9 TRCN0000475025 GATTCCCGACGGCGCCTATTGAGT pLX_317 50.8% 71.7% 90% V5 (many diffs) n/a
10 ccsbBroadEn_00655 pDONR223 100% 71.7% 90% None (many diffs) n/a
11 ccsbBroad304_00655 pLX_304 0% 71.7% 90% V5 (many diffs) n/a
12 TRCN0000472058 GGGAACAATCACATTGATCACTTT pLX_317 45.7% 71.7% 90% V5 (many diffs) n/a
Download CSV