Construct: ORF TRCN0000470538
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004739.1_s317c1
- Derived from:
- ccsbBroadEn_06002
- DNA Barcode:
- CAGTACCTTGGTTTGCTAGCCTAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CHRNA7 (1139)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470538
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 1139 | CHRNA7 | cholinergic receptor nicoti... | XM_017021884.1 | 99.8% | 100% | 726C>T |
| 2 | human | 89832 | CHRFAM7A | CHRNA7 (exons 5-10) and FAM... | NM_148911.1 | 99.5% | 100% | (many diffs) |
| 3 | human | 89832 | CHRFAM7A | CHRNA7 (exons 5-10) and FAM... | XM_005254750.3 | 99.5% | 100% | (many diffs) |
| 4 | human | 1139 | CHRNA7 | cholinergic receptor nicoti... | XM_011521177.2 | 79.9% | 80% | 1_240del;966C>T |
| 5 | human | 89832 | CHRFAM7A | CHRNA7 (exons 5-10) and FAM... | NM_139320.1 | 77.5% | 77.9% | (many diffs) |
| 6 | human | 89832 | CHRFAM7A | CHRNA7 (exons 5-10) and FAM... | XM_011522153.2 | 77.5% | 77.9% | (many diffs) |
| 7 | human | 1139 | CHRNA7 | cholinergic receptor nicoti... | XM_017021883.2 | 72.8% | 72.9% | 1_357del;1083C>T |
| 8 | human | 1139 | CHRNA7 | cholinergic receptor nicoti... | XM_017021882.1 | 72.7% | 72.7% | 1_360del;1086C>T |
| 9 | human | 1139 | CHRNA7 | cholinergic receptor nicoti... | XM_011521176.3 | 65.9% | 66% | 1_495del;1221C>T |
| 10 | human | 1139 | CHRNA7 | cholinergic receptor nicoti... | NM_000746.6 | 63.8% | 63.9% | 1_543del;1269C>T |
| 11 | human | 1139 | CHRNA7 | cholinergic receptor nicoti... | NM_001190455.3 | 60.3% | 60.4% | 1_630del;1356C>T |
| 12 | human | 89832 | CHRFAM7A | CHRNA7 (exons 5-10) and FAM... | XM_011522155.3 | 48.1% | 33.7% | (many diffs) |
| 13 | human | 1139 | CHRNA7 | cholinergic receptor nicoti... | XM_011521178.3 | 39.6% | 27.7% | 1_543del;879_880ins110;1140_1141ins256 |
| 14 | human | 1139 | CHRNA7 | cholinergic receptor nicoti... | NR_046324.1 | 30.3% | 1_465del;1191C>T;1429_3166del | |
| 15 | mouse | 11441 | Chrna7 | cholinergic receptor, nicot... | NM_007390.3 | 55.1% | 59.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1029
- ORF length:
- 963
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgca ggaggcagat atcagtggct atatccccaa tggagaatgg gacctagtgg 121 gaatccccgg caagaggagt gaaaggttct atgagtgctg caaagagccc taccccgatg 181 tcaccttcac agtgaccatg cgccgcagga cgctctacta tggcctcaac ctgctgatcc 241 cctgtgtgct catctccgcc ctcgccctgc tggtgttcct gcttcctgca gattccgggg 301 agaagatttc cctggggata acagtcttac tctctcttac cgtcttcatg ctgctcgtgg 361 ctgagatcat gcccgcaaca tccgattcgg taccattgat agcccagtac ttcgccagca 421 ccatgatcat cgtgggcctc tcggtggtgg tgacagtgat cgtgctgcag taccaccacc 481 acgaccccga cgggggcaag atgcccaagt ggaccagagt catccttcTG AACTGGTGCG 541 CGTGGTTCCT GCGAATGAAG AGGCCCGGGG AGGACAAGGT GCGCCCGGCC TGCCAGCACA 601 AGCAGCGGCG CTGCAGCCTG GCCAGTGTGG AGATGAGCGC CGTGGCGCCG CCGCCCGCCA 661 GCAACGGGAA CCTGCTGTAC ATCGGCTTCC GCGGCCTGGA CGGCGTGCAC TGTGTCCCGA 721 CCCCCGACTC TGGGGTAGTG TGTGGCCGCA TGGCCTGCTC CCCCACGCAC GATGAGCACC 781 TCCTGCACGG TGGGCAACCC CCCGAGGGGG ACCCGGACTT GGCCAAGATC CTGGAGGAGG 841 TCCGCTACAT TGCCAACCGC TTCCGCTGCC AGGACGAAAG CGAGGCGGTC TGCAGCGAGT 901 GGAAGTTCGC CGCCTGTGTG GTGGACCGCC TGTGCCTCAT GGCCTTCTCG GTCTTCACCA 961 TCATCTGCAC CATCGGCATC CTGATGTCGG CTCCCAACTT CGTGGAGGCC GTGTCCAAAG 1021 ACTTTGCGTA CCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 1081 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 1141 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGACAGTAC CTTGGTTTGC TAGCCTATAC 1201 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt