Transcript: Human XM_011521177.2

PREDICTED: Homo sapiens cholinergic receptor nicotinic alpha 7 subunit (CHRNA7), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CHRNA7 (1139)
Length:
5624
CDS:
356..1561

Additional Resources:

NCBI RefSeq record:
XM_011521177.2
NBCI Gene record:
CHRNA7 (1139)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011521177.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437248 ACAGTGCTGATGAGCGCTTTG pLKO_005 399 CDS 100% 6.000 8.400 N CHRNA7 n/a
2 TRCN0000438008 GACAGTGATCGTGCTGCAGTA pLKO_005 982 CDS 100% 4.050 2.430 N CHRNA7 n/a
3 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 3003 3UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
4 TRCN0000241869 GGCAGATATCAGTGGCTATAT pLKO_005 604 CDS 100% 13.200 6.600 Y CHRFAM7A n/a
5 TRCN0000241868 AGAGGAGTGAAAGGTTCTATG pLKO_005 663 CDS 100% 10.800 5.400 Y CHRFAM7A n/a
6 TRCN0000060471 GCAGCACTGCAAACTGAAGTT pLKO.1 535 CDS 100% 4.950 2.475 Y CHRFAM7A n/a
7 TRCN0000060469 CGTGTCCAAAGACTTTGCGTA pLKO.1 1540 CDS 100% 2.640 1.320 Y CHRFAM7A n/a
8 TRCN0000241871 TACCTGCCTCCAGGCATATTC pLKO_005 470 CDS 100% 0.000 0.000 Y CHRFAM7A n/a
9 TRCN0000157610 GTGGCATGATCTCAGCTCATT pLKO.1 2907 3UTR 100% 4.950 2.475 Y CCNJL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011521177.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09274 pDONR223 100% 95.6% 93.9% None (many diffs) n/a
2 ccsbBroad304_09274 pLX_304 0% 95.6% 93.9% V5 (many diffs) n/a
3 TRCN0000470647 TTCCCAGCTACGACTCCCCGATTC pLX_317 38.3% 95.6% 93.9% V5 (many diffs) n/a
4 TRCN0000487766 CATCTTTACATCGCTATTCACAGA pLX_317 20.7% 95.6% 93.9% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000488341 CTACCCCCGCGTCGCTGCAATTCC pLX_317 24.4% 86.7% 84.1% V5 (not translated due to prior stop codon) (many diffs) n/a
6 ccsbBroadEn_06002 pDONR223 100% 79.9% 80% None 1_240del;966C>T n/a
7 ccsbBroad304_06002 pLX_304 0% 79.9% 80% V5 1_240del;966C>T n/a
8 TRCN0000470538 CAGTACCTTGGTTTGCTAGCCTAT pLX_317 51.9% 79.9% 80% V5 1_240del;966C>T n/a
9 ccsbBroadEn_09275 pDONR223 100% 79.8% 80% None (many diffs) n/a
10 ccsbBroad304_09275 pLX_304 0% 79.8% 80% V5 (many diffs) n/a
11 TRCN0000477932 ATAGCAGGATTCACGGGAACGAAT pLX_317 25.9% 79.8% 80% V5 (many diffs) n/a
12 TRCN0000488120 GCAAGGCAGAAGTCCCTCTATTTA pLX_317 17.1% 79.3% 77.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV