Transcript: Human XM_011522155.3

PREDICTED: Homo sapiens CHRNA7 (exons 5-10) and FAM7A (exons A-E) fusion (CHRFAM7A), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CHRFAM7A (89832)
Length:
3417
CDS:
562..1434

Additional Resources:

NCBI RefSeq record:
XM_011522155.3
NBCI Gene record:
CHRFAM7A (89832)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011522155.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000060470 GATATTGCTGATGAGCGCTTT pLKO.1 637 CDS 100% 4.050 5.670 N CHRFAM7A n/a
2 TRCN0000060468 GCAAACTGCGATATTGCTGAT pLKO.1 628 CDS 100% 4.050 3.240 N CHRFAM7A n/a
3 TRCN0000241870 TTTCAGTTCCAATTGCTAATC pLKO_005 589 CDS 100% 10.800 7.560 N CHRFAM7A n/a
4 TRCN0000241872 CAGAACCCATAGGACAAATAA pLKO_005 2487 3UTR 100% 15.000 9.000 N CHRFAM7A n/a
5 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 3134 3UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
6 TRCN0000241869 GGCAGATATCAGTGGCTATAT pLKO_005 843 CDS 100% 13.200 6.600 Y CHRFAM7A n/a
7 TRCN0000241868 AGAGGAGTGAAAGGTTCTATG pLKO_005 902 CDS 100% 10.800 5.400 Y CHRFAM7A n/a
8 TRCN0000060471 GCAGCACTGCAAACTGAAGTT pLKO.1 774 CDS 100% 4.950 2.475 Y CHRFAM7A n/a
9 TRCN0000060472 GCATTTGTGGATAGCTGCAAA pLKO.1 612 CDS 100% 4.950 2.475 Y CHRFAM7A n/a
10 TRCN0000060469 CGTGTCCAAAGACTTTGCGTA pLKO.1 1669 3UTR 100% 2.640 1.320 Y CHRFAM7A n/a
11 TRCN0000241871 TACCTGCCTCCAGGCATATTC pLKO_005 709 CDS 100% 0.000 0.000 Y CHRFAM7A n/a
12 TRCN0000157610 GTGGCATGATCTCAGCTCATT pLKO.1 3038 3UTR 100% 4.950 2.475 Y CCNJL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011522155.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09274 pDONR223 100% 70.1% 55.5% None (many diffs) n/a
2 ccsbBroad304_09274 pLX_304 0% 70.1% 55.5% V5 (many diffs) n/a
3 TRCN0000470647 TTCCCAGCTACGACTCCCCGATTC pLX_317 38.3% 70.1% 55.5% V5 (many diffs) n/a
4 TRCN0000487766 CATCTTTACATCGCTATTCACAGA pLX_317 20.7% 70.1% 55.5% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000488120 GCAAGGCAGAAGTCCCTCTATTTA pLX_317 17.1% 55.7% 41.7% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000488341 CTACCCCCGCGTCGCTGCAATTCC pLX_317 24.4% 54.8% 37.8% V5 (not translated due to prior stop codon) (many diffs) n/a
7 ccsbBroadEn_06002 pDONR223 100% 48.1% 33.7% None (many diffs) n/a
8 ccsbBroad304_06002 pLX_304 0% 48.1% 33.7% V5 (many diffs) n/a
9 TRCN0000470538 CAGTACCTTGGTTTGCTAGCCTAT pLX_317 51.9% 48.1% 33.7% V5 (many diffs) n/a
10 ccsbBroadEn_09275 pDONR223 100% 48% 33.7% None (many diffs) n/a
11 ccsbBroad304_09275 pLX_304 0% 48% 33.7% V5 (many diffs) n/a
12 TRCN0000477932 ATAGCAGGATTCACGGGAACGAAT pLX_317 25.9% 48% 33.7% V5 (many diffs) n/a
Download CSV