Transcript: Mouse NM_007390.3

Mus musculus cholinergic receptor, nicotinic, alpha polypeptide 7 (Chrna7), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Chrna7 (11441)
Length:
2091
CDS:
51..1559

Additional Resources:

NCBI RefSeq record:
NM_007390.3
NBCI Gene record:
Chrna7 (11441)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007390.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102958 CTCCTCTATAACAGTGCAGAT pLKO.1 387 CDS 100% 4.050 5.670 N Chrna7 n/a
2 TRCN0000102955 CCCAGCAGCTTCTGTTTACTT pLKO.1 1714 3UTR 100% 5.625 3.938 N Chrna7 n/a
3 TRCN0000102957 CAGATTTGGAAACCAGACATT pLKO.1 366 CDS 100% 4.950 3.465 N Chrna7 n/a
4 TRCN0000102956 GCAGTGGAACATGTCTGAGTA pLKO.1 311 CDS 100% 4.950 3.465 N Chrna7 n/a
5 TRCN0000102959 CCAGGATCATTCTTCTGAATT pLKO.1 1042 CDS 100% 0.000 0.000 N Chrna7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007390.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488120 GCAAGGCAGAAGTCCCTCTATTTA pLX_317 17.1% 87.9% 93.2% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_09274 pDONR223 100% 70.2% 72.1% None (many diffs) n/a
3 ccsbBroad304_09274 pLX_304 0% 70.2% 72.1% V5 (many diffs) n/a
4 TRCN0000470647 TTCCCAGCTACGACTCCCCGATTC pLX_317 38.3% 70.2% 72.1% V5 (many diffs) n/a
5 TRCN0000487766 CATCTTTACATCGCTATTCACAGA pLX_317 20.7% 70.2% 72.1% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000488341 CTACCCCCGCGTCGCTGCAATTCC pLX_317 24.4% 60.2% 62.6% V5 (not translated due to prior stop codon) (many diffs) n/a
7 ccsbBroadEn_06002 pDONR223 100% 55.1% 59.3% None (many diffs) n/a
8 ccsbBroad304_06002 pLX_304 0% 55.1% 59.3% V5 (many diffs) n/a
9 TRCN0000470538 CAGTACCTTGGTTTGCTAGCCTAT pLX_317 51.9% 55.1% 59.3% V5 (many diffs) n/a
10 ccsbBroadEn_09275 pDONR223 100% 55.1% 59.3% None (many diffs) n/a
11 ccsbBroad304_09275 pLX_304 0% 55.1% 59.3% V5 (many diffs) n/a
12 TRCN0000477932 ATAGCAGGATTCACGGGAACGAAT pLX_317 25.9% 55.1% 59.3% V5 (many diffs) n/a
Download CSV