Construct: ORF TRCN0000470685
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018865.1_s317c1
- Derived from:
- ccsbBroadEn_15005
- DNA Barcode:
- TTCAGCCAGAAATAAAATGGCCAT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- CDK19 (23097)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470685
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 23097 | CDK19 | cyclin dependent kinase 19 | NM_015076.5 | 92.3% | 9.7% | (many diffs) |
| 2 | human | 23097 | CDK19 | cyclin dependent kinase 19 | NM_001300960.2 | 85% | 10.6% | (many diffs) |
| 3 | human | 23097 | CDK19 | cyclin dependent kinase 19 | XM_024446376.1 | 81.9% | 1.9% | (many diffs) |
| 4 | human | 23097 | CDK19 | cyclin dependent kinase 19 | NM_001300963.1 | 80.9% | 2.6% | (many diffs) |
| 5 | human | 23097 | CDK19 | cyclin dependent kinase 19 | NM_001300964.2 | 80.9% | 2.6% | (many diffs) |
| 6 | human | 23097 | CDK19 | cyclin dependent kinase 19 | XM_024446377.1 | 80.9% | 2.6% | (many diffs) |
| 7 | human | 23097 | CDK19 | cyclin dependent kinase 19 | XM_024446378.1 | 80.9% | 2.6% | (many diffs) |
| 8 | human | 23097 | CDK19 | cyclin dependent kinase 19 | XM_024446379.1 | 80.9% | 2.6% | (many diffs) |
| 9 | human | 23097 | CDK19 | cyclin dependent kinase 19 | XM_024446380.1 | 80.9% | 2.6% | (many diffs) |
| 10 | human | 23097 | CDK19 | cyclin dependent kinase 19 | XM_024446381.1 | 80.9% | 2.6% | (many diffs) |
| 11 | human | 23097 | CDK19 | cyclin dependent kinase 19 | XM_017010587.2 | 80.8% | 2.6% | (many diffs) |
| 12 | human | 23097 | CDK19 | cyclin dependent kinase 19 | XM_011535630.2 | 75.5% | 2.1% | (many diffs) |
| 13 | human | 23097 | CDK19 | cyclin dependent kinase 19 | XM_011535631.2 | 68.7% | 2.2% | (many diffs) |
| 14 | human | 23097 | CDK19 | cyclin dependent kinase 19 | XM_005266871.3 | 67.6% | 3% | (many diffs) |
| 15 | human | 23097 | CDK19 | cyclin dependent kinase 19 | XM_017010588.1 | 60.7% | 3.4% | (many diffs) |
| 16 | human | 23097 | CDK19 | cyclin dependent kinase 19 | XM_011535632.2 | 49.9% | 2.3% | (many diffs) |
| 17 | mouse | 78334 | Cdk19 | cyclin-dependent kinase 19 | NM_001168304.1 | 83.5% | 9.7% | (many diffs) |
| 18 | mouse | 78334 | Cdk19 | cyclin-dependent kinase 19 | NM_198164.3 | 76.9% | 10.6% | (many diffs) |
| 19 | mouse | 78334 | Cdk19 | cyclin-dependent kinase 19 | NM_001291816.1 | 62.5% | 3% | (many diffs) |
| 20 | mouse | 78334 | Cdk19 | cyclin-dependent kinase 19 | XM_017314164.1 | 62.5% | 3% | (many diffs) |
| 21 | mouse | 78334 | Cdk19 | cyclin-dependent kinase 19 | NM_001291817.1 | 53.8% | 3.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 282
- ORF length:
- 213
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggattatgat ttcaaggcga agctggcggc ggagcgggag cgggtggagg 121 atttgtttga gtacgaaggg tgcaaagtgg gacgcggcac ctacggtcac gtctacaagg 181 cgaggcggaa agatggattc caggagggct tcgtgtatgg acctcaagcg ttggaggtag 241 cagacttttc agcagaagaa aagatgaaaa ggaatatgca ttgaagcaaa ttgaaggcac 301 aggaatatcc gtgtcggctt gtacagagat tgcacttttg caagaattga atcaccctaa 361 tgtgattgca ttgcaaaatg tgttcctttc tcacattgac acgaacgtat ggctgctgtt 421 tgattatgca gagcatgact tgaggcatat tattaacttt caccgtgcat cataagcaaa 481 taaaaagctc atgccgttgc caagatctat ggttaaatcc ttactttacc agattcttga 541 tggtatccat tacctccatg caaattgggt gcttcacaga gacttgaaac cagcatatat 601 cctaataatg gtagaaggtc ctgacacgag gagagtcaaa atagctgaca tggattttgc 661 cagatcattc aattctcctc taacgccact agcagatttg gatccagtac atgtgacatt 721 ttgctatcgg gctcaaatct tttgcttgtg ccatgcatta tacaaatgtc attgatatat 781 ggacatagtt gtatatttgc tcaattcgtc gacttcagca gctattgtat cactgtcgtc 841 atggaggatt tcataannaa tgcaatccct tttcatcatg atcaactgga tcggatattt 901 agtgtcatgg ggtttcctgc agataaagac tgggaagata tangaaagat gccagaatat 961 cccacacttc aaaaaagact ttagaagaac aacgtatgcc aacagtagcc tcataaagta 1021 catggagaaa cacaaggtca agcctgacag caaagtgttc ctcttgcttc agaaactcct 1081 gaccatggat ccaaccaaga gaattacctc ggagcaagct ctgcaggatc cctattttca 1141 ggaggaccct ttgccaacat tagatgtatt tgccggctgc cagattccat accccaaacg 1201 agaattcctt aatgaagatg atcctgaaga aaaaggtgac aaGAATCAGC AACAGCAGCA 1261 GAACCAGCAT CAGCAGCCCA CAGCCCCTCC ACAGCAGGCA GCAGCCCCTC CACAGGCGCC 1321 CCCACCACAG CAGAACAGCA CCCAGACCAA CGGGACCGCA GGTGGGGCTG GGGCCGGGGT 1381 CGGGGGCACC GGAGCAGGGT TGCAGCACAG CCAGGACTCC AGCCTGAACC AGGTGCCTCC 1441 AAACAAGAAG CCACGGCTAG GGCCTTCAGG CGCAAACTCA GGTGGACCTG TGATGCCCTC 1501 GGATTATCAG CACTCCAGTT CTCGCCTGAA TTACCAAAGC AGCGTTCAGG GATCCTCTCA 1561 GTCCCAGAGC ACACTTGGCT ACTCTTCCTC GTCTCAGCAG AGCTCACAGT ACCACCCATC 1621 TCACCAGGCC CACCGGTACT TGCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC 1681 TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA 1741 AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGATTCAG CCAGAAATAA 1801 AATGGCCATA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg tgaaagatt