Transcript: Mouse XM_011250125.2

PREDICTED: Mus musculus clavesin 1 (Clvs1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Clvs1 (74438)
Length:
3632
CDS:
354..1418

Additional Resources:

NCBI RefSeq record:
XM_011250125.2
NBCI Gene record:
Clvs1 (74438)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011250125.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105400 GCCTTCATTCTGCGATTTCTT pLKO.1 573 CDS 100% 5.625 7.875 N Clvs1 n/a
2 TRCN0000105402 CGTACAGATGATGCCTTCATT pLKO.1 561 CDS 100% 5.625 3.938 N Clvs1 n/a
3 TRCN0000105403 GCTCGTCTGGAACTGAATGAA pLKO.1 465 CDS 100% 5.625 3.938 N Clvs1 n/a
4 TRCN0000105401 CATTCAACAAGTCAGAGACAT pLKO.1 509 CDS 100% 4.950 3.465 N Clvs1 n/a
5 TRCN0000105404 TGATGCCTTCATTCTGCGATT pLKO.1 569 CDS 100% 4.050 2.835 N Clvs1 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2191 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011250125.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14413 pDONR223 100% 89.4% 96.3% None (many diffs) n/a
2 ccsbBroad304_14413 pLX_304 0% 89.4% 96.3% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000470813 CTTCCTCTACTCAGTTTCCTACCG pLX_317 41.9% 89.4% 96.3% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV