Transcript: Mouse XM_006512545.3

PREDICTED: Mus musculus glutamate receptor, ionotropic, kainate 2 (beta 2) (Grik2), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Grik2 (14806)
Length:
9918
CDS:
787..3468

Additional Resources:

NCBI RefSeq record:
XM_006512545.3
NBCI Gene record:
Grik2 (14806)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006512545.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100274 CGTTTATGACTCTTGGAATAA pLKO.1 2381 CDS 100% 13.200 10.560 N Grik2 n/a
2 TRCN0000100271 GCCGTTTATGACTCTTGGAAT pLKO.1 2379 CDS 100% 4.950 3.960 N Grik2 n/a
3 TRCN0000100272 CCTCCGATTATGCTTTCTTAA pLKO.1 2975 CDS 100% 13.200 9.240 N Grik2 n/a
4 TRCN0000100273 GCATTCAGATTTGCTGTGAAT pLKO.1 952 CDS 100% 0.495 0.347 N Grik2 n/a
5 TRCN0000100270 GTTATCAACATGCACACATTT pLKO.1 3593 3UTR 100% 13.200 7.920 N Grik2 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5465 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006512545.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13864 pDONR223 100% 59.6% 63.9% None (many diffs) n/a
2 ccsbBroad304_13864 pLX_304 0% 59.6% 63.9% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000471328 TCAAACTAGATTACAATTCGATTC pLX_317 18.9% 59.6% 63.9% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_10863 pDONR223 100% 34% 34.7% None (many diffs) n/a
5 ccsbBroad304_10863 pLX_304 0% 34% 34.7% V5 (many diffs) n/a
6 TRCN0000471009 TTGCTGATAGATCAATTCTGAAGC pLX_317 31.6% 34% 34.7% V5 (many diffs) n/a
Download CSV