Transcript: Human XM_017010781.2

PREDICTED: Homo sapiens glutamate ionotropic receptor kainate type subunit 2 (GRIK2), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GRIK2 (2898)
Length:
11587
CDS:
424..2547

Additional Resources:

NCBI RefSeq record:
XM_017010781.2
NBCI Gene record:
GRIK2 (2898)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010781.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425213 CTCTATGGTAATGATCGATTT pLKO_005 1780 CDS 100% 10.800 8.640 N GRIK2 n/a
2 TRCN0000063201 CCAATCGTTCTTTGATTGTTA pLKO.1 1709 CDS 100% 0.563 0.450 N GRIK2 n/a
3 TRCN0000063200 CCCAATACTACCCTTACCTAT pLKO.1 637 CDS 100% 4.950 3.465 N GRIK2 n/a
4 TRCN0000063198 GCCCTTTATGACACTTGGAAT pLKO.1 2016 CDS 100% 4.950 3.465 N GRIK2 n/a
5 TRCN0000063202 CCTGCTCTGTTTACTGTGGAT pLKO.1 480 CDS 100% 2.640 1.848 N GRIK2 n/a
6 TRCN0000100273 GCATTCAGATTTGCTGTGAAT pLKO.1 589 CDS 100% 0.495 0.297 N Grik2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010781.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13864 pDONR223 100% 82.4% 82% None 1740delC;1750_2121del n/a
2 ccsbBroad304_13864 pLX_304 0% 82.4% 82% V5 (not translated due to prior stop codon) 1740delC;1750_2121del n/a
3 TRCN0000471328 TCAAACTAGATTACAATTCGATTC pLX_317 18.9% 82.4% 82% V5 (not translated due to prior stop codon) 1740delC;1750_2121del n/a
4 ccsbBroadEn_10863 pDONR223 100% 47.9% 44.6% None (many diffs) n/a
5 ccsbBroad304_10863 pLX_304 0% 47.9% 44.6% V5 (many diffs) n/a
6 TRCN0000471009 TTGCTGATAGATCAATTCTGAAGC pLX_317 31.6% 47.9% 44.6% V5 (many diffs) n/a
Download CSV