Construct: ORF TRCN0000471229
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014202.1_s317c1
- Derived from:
- ccsbBroadEn_02766
- DNA Barcode:
- GAAGTCACCCTACTTATAAGCTCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GPR161 (23432)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471229
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 23432 | GPR161 | G protein-coupled receptor 161 | NM_001267610.1 | 100% | 100% | |
| 2 | human | 23432 | GPR161 | G protein-coupled receptor 161 | NM_001349632.1 | 100% | 100% | |
| 3 | human | 23432 | GPR161 | G protein-coupled receptor 161 | NM_001349633.1 | 100% | 100% | |
| 4 | human | 23432 | GPR161 | G protein-coupled receptor 161 | NM_001349634.1 | 100% | 100% | |
| 5 | human | 23432 | GPR161 | G protein-coupled receptor 161 | NM_153832.2 | 100% | 100% | |
| 6 | human | 23432 | GPR161 | G protein-coupled receptor 161 | XM_005245056.2 | 100% | 100% | |
| 7 | human | 23432 | GPR161 | G protein-coupled receptor 161 | XM_005245057.4 | 100% | 100% | |
| 8 | human | 23432 | GPR161 | G protein-coupled receptor 161 | XM_011509376.2 | 100% | 100% | |
| 9 | human | 23432 | GPR161 | G protein-coupled receptor 161 | XM_011509378.1 | 100% | 100% | |
| 10 | human | 23432 | GPR161 | G protein-coupled receptor 161 | NM_001267611.1 | 96.8% | 96.8% | 1_51del |
| 11 | human | 23432 | GPR161 | G protein-coupled receptor 161 | NM_001267609.1 | 96.3% | 96.3% | 1_60del |
| 12 | human | 23432 | GPR161 | G protein-coupled receptor 161 | XM_005245055.2 | 96.3% | 96.3% | 1_60del |
| 13 | human | 23432 | GPR161 | G protein-coupled receptor 161 | XM_006711251.1 | 95.8% | 95.8% | 1_69del |
| 14 | human | 23432 | GPR161 | G protein-coupled receptor 161 | XM_011509371.2 | 95.8% | 95.8% | 1_69del |
| 15 | human | 23432 | GPR161 | G protein-coupled receptor 161 | XM_011509372.1 | 95.8% | 95.8% | 1_69del |
| 16 | human | 23432 | GPR161 | G protein-coupled receptor 161 | XM_011509373.2 | 95.8% | 95.8% | 1_69del |
| 17 | human | 23432 | GPR161 | G protein-coupled receptor 161 | XM_006711253.2 | 86.8% | 86.8% | 1_240del |
| 18 | human | 23432 | GPR161 | G protein-coupled receptor 161 | NM_001267613.1 | 81.5% | 72% | (many diffs) |
| 19 | human | 23432 | GPR161 | G protein-coupled receptor 161 | NM_001267614.1 | 77.7% | 76.9% | (many diffs) |
| 20 | human | 23432 | GPR161 | G protein-coupled receptor 161 | NM_001267612.1 | 75% | 75% | 0_1ins396 |
| 21 | human | 23432 | GPR161 | G protein-coupled receptor 161 | NM_001349635.1 | 75% | 75% | 0_1ins396 |
| 22 | mouse | 240888 | Gpr161 | G protein-coupled receptor 161 | NM_001310430.1 | 87.9% | 92.8% | (many diffs) |
| 23 | mouse | 240888 | Gpr161 | G protein-coupled receptor 161 | XM_006496850.3 | 87.9% | 92.8% | (many diffs) |
| 24 | mouse | 240888 | Gpr161 | G protein-coupled receptor 161 | XM_006496851.3 | 87.9% | 92.8% | (many diffs) |
| 25 | mouse | 240888 | Gpr161 | G protein-coupled receptor 161 | XM_006496852.3 | 87.9% | 92.8% | (many diffs) |
| 26 | mouse | 240888 | Gpr161 | G protein-coupled receptor 161 | XM_011238821.2 | 87.9% | 92.8% | (many diffs) |
| 27 | mouse | 240888 | Gpr161 | G protein-coupled receptor 161 | NM_001310429.1 | 85.2% | 89.9% | (many diffs) |
| 28 | mouse | 240888 | Gpr161 | G protein-coupled receptor 161 | NM_001081126.2 | 83.2% | 87.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1653
- ORF length:
- 1587
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag cctcaactcc tccctcagct gcaggaagga gctgagtaat ctcactgagg 121 aggagggtgg cgaagggggc gtcatcatca cccagttcat cgccatcatt gtcatcacca 181 tttttgtctg cctgggaaac ctggtcatcg tggtcacctt gtacaagaag tcctacctcc 241 tcaccctcag caacaagttc gtcttcagcc tgactctgtc caacttcctg ctgtccgtgt 301 tggtgctgcc ttttgtggtg acgagctcca tccgcaggga atggatcttt ggtgtagtgt 361 ggtgcaactt ctctgccctc ctctacctgc tgatcagctc tgccagcatg ctaaccctcg 421 gggtcattgc catcgaccgc tactatgctg tcctgtaccc catggtgtac cccatgaaga 481 tcacagggaa ccgggctgtg atggcacttg tctacatctg gcttcactcg ctcatcggct 541 gcctgccacc cctgtttggt tggtcatccg tggagtttga cgagttcaaa tggatgtgtg 601 tggctgcttg gcaccgggag cctggctaca cggccttctg gcagatctgg tgtgccctct 661 tcccctttct ggtcatgctg gtgtgctatg gcttcatctt ccgcgtggcc agggtcaagg 721 cacgcaaggt gcactgtggc acagtcgtca tcgtggagga ggatgctcag aggaccggga 781 ggaagaactc cagcacctcc acctcctctt caggcagcag gaggaatgcc tttcagggtg 841 tggtctactc ggccaaccag tgcaaagccc tcatcaccat cctggtggtc ctcggtgcct 901 tcatggtcac ctggggcccc tacatggttg tcatcgcctc tgaggccctc tgggggaaaa 961 gctccgtctc cccgagcctg gagacttggg ccacatggct gtcctttgcc agcgctgtct 1021 gccaccccct gatctatgga ctctggaaca agacagttcg caaagaacta ctgggcatgt 1081 gctttgggga ccggtattat cgggaaccat ttgtgcaacg acagaggact tccaggctct 1141 tcagcatttc caacaggatc acagacctgg gcctgtcccc acacctcact gcgctcatgg 1201 caggtggaca gcccctgggg cacagcagca gcacgggGGA CACTGGCTTC AGCTGCTCCC 1261 AGGACTCAGG GACAGATATG ATGCTGCTTG AGGACTACAC GTCTGATGAC AACCCTCCCT 1321 CTCACTGCAC TTGCCCACCC AAGAGAAGGA GCTCGGTGAC ATTTGAGGAT GAAGTGGAAC 1381 AAATCAAAGA AGCTGCCAAG AACTCGATTC TTCATGTGAA AGCTGAAGTA CACAAGTCCT 1441 TGGACAGTTA CGCAGCAAGC TTGGCCAAAG CCATTGAGGC CGAAGCCAAA ATCAACTTAT 1501 TTGGGGAGGA GGCTTTGCCA GGGGTCTTGG TTACAGCACG GACTGTCCCG GGGGGCGGCT 1561 TCGGGGGCCG CCGAGGCAGC AGAACTCTTG TGAGCCAGAG GCTGCAGTTG CAGAGCATCG 1621 AAGAAGGAGA TGTTTTAGCT GCCGAGCAGA GATGCCCAAC TTTCTTGTAC AAAGTGGTTG 1681 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 1741 GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGAGA 1801 AGTCACCCTA CTTATAAGCT CGACGCGTTA AGTCgacaat caacctctgg attacaaaat 1861 ttgtgaaaga tt