Transcript: Mouse NM_001331209.1

Mus musculus cyclin M3 (Cnnm3), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-02-26
Taxon:
Mus musculus (mouse)
Gene:
Cnnm3 (94218)
Length:
5190
CDS:
45..2183

Additional Resources:

NCBI RefSeq record:
NM_001331209.1
NBCI Gene record:
Cnnm3 (94218)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001331209.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000077845 GCGAGTCTCTGAGAAAGTCTT pLKO.1 1601 CDS 100% 4.950 3.960 N Cnnm3 n/a
2 TRCN0000222755 CTCAAAGACTTGGCTATCGTT pLKO.1 1155 CDS 100% 3.000 2.400 N Cnnm3 n/a
3 TRCN0000077844 CCAGCCAGTAGATTACTTCAT pLKO.1 1715 CDS 100% 4.950 3.465 N Cnnm3 n/a
4 TRCN0000077846 CTGCACATACTGTCCTGACTA pLKO.1 1922 CDS 100% 4.950 3.465 N Cnnm3 n/a
5 TRCN0000077843 GCTGGAAATGGACAAGCGTTT pLKO.1 2205 3UTR 100% 4.050 2.835 N Cnnm3 n/a
6 TRCN0000045221 AGGTGTCTGATGATGAATATA pLKO.1 1504 CDS 100% 15.000 9.000 N CNNM3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001331209.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000470877 GCCCTTTAGGCACCTCGCCTTCAT pLX_317 21% 85% 86% V5 (many diffs) n/a
2 ccsbBroadEn_15784 pDONR223 0% 39.5% 38.8% None (many diffs) n/a
3 ccsbBroad304_15784 pLX_304 0% 39.5% 38.8% V5 (many diffs) n/a
4 TRCN0000471412 ATTGACTTGCACAAAAGTTAACAC pLX_317 27% 39.5% 38.8% V5 (many diffs) n/a
Download CSV