Transcript: Human XR_001738700.2

PREDICTED: Homo sapiens cyclin and CBS domain divalent metal cation transport mediator 3 (CNNM3), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CNNM3 (26505)
Length:
4698
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001738700.2
NBCI Gene record:
CNNM3 (26505)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001738700.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045222 GCCGGTGGATTACTTCATTCT pLKO.1 2838 3UTR 100% 4.950 6.930 N CNNM3 n/a
2 TRCN0000045218 GCACGCATTCATCTGCGTATT pLKO.1 3032 3UTR 100% 1.080 1.512 N CNNM3 n/a
3 TRCN0000045219 GAGGGTCTGAAGTTTGAGAAT pLKO.1 2896 3UTR 100% 4.950 3.465 N CNNM3 n/a
4 TRCN0000045220 CTTCGTCTTCAACGACACCAA pLKO.1 2496 3UTR 100% 2.640 1.848 N CNNM3 n/a
5 TRCN0000045221 AGGTGTCTGATGATGAATATA pLKO.1 2624 3UTR 100% 15.000 9.000 N CNNM3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001738700.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000470877 GCCCTTTAGGCACCTCGCCTTCAT pLX_317 21% 40.8% V5 (many diffs) n/a
2 ccsbBroadEn_15784 pDONR223 0% 22.6% None (many diffs) n/a
3 ccsbBroad304_15784 pLX_304 0% 22.6% V5 (many diffs) n/a
4 TRCN0000471412 ATTGACTTGCACAAAAGTTAACAC pLX_317 27% 22.6% V5 (many diffs) n/a
Download CSV