Transcript: Mouse NM_001037761.2

Mus musculus capping protein (actin filament) muscle Z-line, beta (Capzb), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Capzb (12345)
Length:
1789
CDS:
128..961

Additional Resources:

NCBI RefSeq record:
NM_001037761.2
NBCI Gene record:
Capzb (12345)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001037761.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305997 TATAGGTCACCGTGGAGTAAC pLKO_005 338 CDS 100% 10.800 15.120 N Capzb n/a
2 TRCN0000091883 CACGCCATGCACTCGTTAGGT pLKO.1 1085 3UTR 100% 1.000 1.400 N Capzb n/a
3 TRCN0000325512 CACGCCATGCACTCGTTAGGT pLKO_005 1085 3UTR 100% 1.000 1.400 N Capzb n/a
4 TRCN0000305932 ATGGATCCAAGAAGATCAAAG pLKO_005 543 CDS 100% 10.800 7.560 N Capzb n/a
5 TRCN0000091884 GCAGACAAATCAAAGCAAGAA pLKO.1 988 3UTR 100% 4.950 3.465 N Capzb n/a
6 TRCN0000325587 GCAGACAAATCAAAGCAAGAA pLKO_005 988 3UTR 100% 4.950 3.465 N Capzb n/a
7 TRCN0000091886 GTGCAGACGTTTGCAGACAAA pLKO.1 976 3UTR 100% 4.950 3.465 N Capzb n/a
8 TRCN0000325511 GTGCAGACGTTTGCAGACAAA pLKO_005 976 3UTR 100% 4.950 3.465 N Capzb n/a
9 TRCN0000091885 CGGCTCAGAAAGCTGGAGGTA pLKO.1 401 CDS 100% 0.880 0.616 N Capzb n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001037761.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00218 pDONR223 100% 86.6% 90.6% None (many diffs) n/a
2 ccsbBroad304_00218 pLX_304 0% 86.6% 90.6% V5 (many diffs) n/a
3 TRCN0000472378 GTTACTGCGCTTCTCCCTAGTCGT pLX_317 55.5% 86.6% 90.6% V5 (many diffs) n/a
Download CSV