Transcript: Mouse XM_017316161.1

PREDICTED: Mus musculus methyltransferase like 6 (Mettl6), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mettl6 (67011)
Length:
1946
CDS:
108..1103

Additional Resources:

NCBI RefSeq record:
XM_017316161.1
NBCI Gene record:
Mettl6 (67011)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017316161.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000312975 AGATGGAACCAGATCGTATTT pLKO_005 896 CDS 100% 13.200 18.480 N Mettl6 n/a
2 TRCN0000097556 CCTTGTCTTACTAAACGTGTA pLKO.1 761 CDS 100% 4.050 5.670 N Mettl6 n/a
3 TRCN0000097557 GCCTTGTCTTACTAAACGTGT pLKO.1 760 CDS 100% 2.640 3.696 N Mettl6 n/a
4 TRCN0000311952 GCCTTGTCTTACTAAACGTGT pLKO_005 760 CDS 100% 2.640 3.696 N Mettl6 n/a
5 TRCN0000313020 TCACGCCATGCTTAGATTTAA pLKO_005 836 CDS 100% 15.000 10.500 N Mettl6 n/a
6 TRCN0000312977 TGCAGGCAAACACCCAAATTA pLKO_005 1432 3UTR 100% 15.000 10.500 N Mettl6 n/a
7 TRCN0000375385 TTTCGAGAGACAGTGAATAAA pLKO_005 987 CDS 100% 15.000 10.500 N Mettl6 n/a
8 TRCN0000375392 AGGTTTGGCAATTTGAGTTTA pLKO_005 1469 3UTR 100% 13.200 9.240 N Mettl6 n/a
9 TRCN0000097554 GCAGCTCACTTCCATCAGTAA pLKO.1 1350 3UTR 100% 4.950 3.465 N Mettl6 n/a
10 TRCN0000097555 GCAGTTGACTACGTGAAGCAA pLKO.1 597 CDS 100% 3.000 2.100 N Mettl6 n/a
11 TRCN0000097558 CCAGTGACTCTGCTTCACTTT pLKO.1 1081 CDS 100% 0.495 0.297 N Mettl6 n/a
12 TRCN0000363592 CCAGTGACTCTGCTTCACTTT pLKO_005 1081 CDS 100% 0.495 0.297 N Mettl6 n/a
13 TRCN0000196149 GCACAGACATACATGCAGGTA pLKO.1 1419 3UTR 100% 2.640 1.320 Y Lypd6b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017316161.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13166 pDONR223 100% 67.1% 68.2% None (many diffs) n/a
2 ccsbBroad304_13166 pLX_304 0% 67.1% 68.2% V5 (many diffs) n/a
3 TRCN0000472430 GCATCTCCCCTCTCATTAAAATCA pLX_317 46.7% 67.1% 68.2% V5 (many diffs) n/a
Download CSV