Transcript: Human XM_017005722.2

PREDICTED: Homo sapiens methyltransferase like 6 (METTL6), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
METTL6 (131965)
Length:
6123
CDS:
247..825

Additional Resources:

NCBI RefSeq record:
XM_017005722.2
NBCI Gene record:
METTL6 (131965)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005722.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151121 GATCCGAATATCTTTGCCTAT pLKO.1 547 CDS 100% 4.050 5.670 N METTL6 n/a
2 TRCN0000152034 CCAAACTTTGGTGTCTGATTT pLKO.1 321 CDS 100% 13.200 10.560 N METTL6 n/a
3 TRCN0000417999 CCTTTCATGAGGTTGGCATTT pLKO_005 960 3UTR 100% 10.800 8.640 N METTL6 n/a
4 TRCN0000428116 TCTCCAAGAGCCATTGAATAT pLKO_005 580 CDS 100% 13.200 9.240 N METTL6 n/a
5 TRCN0000419802 TCTTTATGGACACAGGTTATG pLKO_005 793 CDS 100% 10.800 7.560 N METTL6 n/a
6 TRCN0000157967 CCAGAGAGTTTGAGGAGCTAA pLKO.1 437 CDS 100% 4.950 3.465 N METTL6 n/a
7 TRCN0000152989 GACCAAACTTTGGTGTCTGAT pLKO.1 319 CDS 100% 4.950 3.465 N METTL6 n/a
8 TRCN0000150694 GCTAAGATCATGTAGAGAGTT pLKO.1 453 CDS 100% 4.950 3.465 N METTL6 n/a
9 TRCN0000151394 GATGATCTTCTGGATCATGTA pLKO.1 664 CDS 100% 0.495 0.347 N METTL6 n/a
10 TRCN0000156879 GCAAGGATTCTCACCTCTGAA pLKO.1 277 CDS 100% 4.950 2.970 N METTL6 n/a
11 TRCN0000152400 GATACAGAAAGATGCAAGGTA pLKO.1 622 CDS 100% 3.000 1.800 N METTL6 n/a
12 TRCN0000143567 GATCATCTGAAGTCAGGAGTT pLKO.1 5344 3UTR 100% 4.050 2.025 Y GDPD1 n/a
13 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1041 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005722.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13166 pDONR223 100% 75.2% 67.5% None 530_531ins142;576_577ins47 n/a
2 ccsbBroad304_13166 pLX_304 0% 75.2% 67.5% V5 530_531ins142;576_577ins47 n/a
3 TRCN0000472430 GCATCTCCCCTCTCATTAAAATCA pLX_317 46.7% 75.2% 67.5% V5 530_531ins142;576_577ins47 n/a
Download CSV