Construct: ORF TRCN0000472524
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011766.2_s317c1
- Derived from:
- ccsbBroadEn_06771
- DNA Barcode:
- AGTACGTGTTCTAGAGGGTTTGTA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PRKACB (5567)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472524
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5567 | PRKACB | protein kinase cAMP-activat... | NM_002731.3 | 99.7% | 99.1% | 475C>A;487C>A;781C>A |
| 2 | human | 5567 | PRKACB | protein kinase cAMP-activat... | XM_005271018.4 | 96.5% | 96% | (many diffs) |
| 3 | human | 5567 | PRKACB | protein kinase cAMP-activat... | NM_001242858.2 | 95.8% | 94.5% | (many diffs) |
| 4 | human | 5567 | PRKACB | protein kinase cAMP-activat... | XM_005271017.3 | 95.7% | 96.2% | (many diffs) |
| 5 | human | 5567 | PRKACB | protein kinase cAMP-activat... | XM_005271019.1 | 95.7% | 95.1% | (many diffs) |
| 6 | human | 5567 | PRKACB | protein kinase cAMP-activat... | XM_005271016.1 | 95.6% | 95.1% | (many diffs) |
| 7 | human | 5567 | PRKACB | protein kinase cAMP-activat... | NM_001242859.2 | 95.4% | 94.9% | (many diffs) |
| 8 | human | 5567 | PRKACB | protein kinase cAMP-activat... | XM_006710758.2 | 95.2% | 95.2% | (many diffs) |
| 9 | human | 5567 | PRKACB | protein kinase cAMP-activat... | XM_005271015.3 | 94.9% | 95.7% | (many diffs) |
| 10 | human | 5567 | PRKACB | protein kinase cAMP-activat... | NM_001242857.2 | 94.6% | 94.1% | (many diffs) |
| 11 | human | 5567 | PRKACB | protein kinase cAMP-activat... | NM_001242860.2 | 94.4% | 94.3% | (many diffs) |
| 12 | human | 5567 | PRKACB | protein kinase cAMP-activat... | NM_001242862.2 | 92.9% | 89% | (many diffs) |
| 13 | human | 5567 | PRKACB | protein kinase cAMP-activat... | NM_182948.4 | 86.3% | 84.6% | (many diffs) |
| 14 | human | 5567 | PRKACB | protein kinase cAMP-activat... | NM_001242861.2 | 86% | 85.9% | (many diffs) |
| 15 | human | 5566 | PRKACA | protein kinase cAMP-activat... | NM_002730.4 | 77.1% | 92% | (many diffs) |
| 16 | human | 5566 | PRKACA | protein kinase cAMP-activat... | NM_207518.3 | 74.9% | 88.6% | (many diffs) |
| 17 | human | 5567 | PRKACB | protein kinase cAMP-activat... | XM_017001713.2 | 73.1% | 72.3% | (many diffs) |
| 18 | human | 5567 | PRKACB | protein kinase cAMP-activat... | NM_207578.3 | 72.9% | 72.6% | (many diffs) |
| 19 | human | 5567 | PRKACB | protein kinase cAMP-activat... | XM_017001717.1 | 69.8% | 69.5% | (many diffs) |
| 20 | human | 5567 | PRKACB | protein kinase cAMP-activat... | XM_017001714.1 | 69.4% | 68.5% | (many diffs) |
| 21 | human | 5567 | PRKACB | protein kinase cAMP-activat... | XM_017001709.1 | 69.4% | 68.5% | (many diffs) |
| 22 | human | 5567 | PRKACB | protein kinase cAMP-activat... | XM_017001716.1 | 69.3% | 69.8% | (many diffs) |
| 23 | human | 5567 | PRKACB | protein kinase cAMP-activat... | XM_017001710.2 | 69.2% | 68.7% | (many diffs) |
| 24 | human | 5567 | PRKACB | protein kinase cAMP-activat... | XM_017001718.2 | 69.2% | 67.8% | (many diffs) |
| 25 | human | 5567 | PRKACB | protein kinase cAMP-activat... | XM_017001715.1 | 69.2% | 68.8% | (many diffs) |
| 26 | human | 5567 | PRKACB | protein kinase cAMP-activat... | XM_017001711.1 | 69.2% | 68.8% | (many diffs) |
| 27 | human | 5567 | PRKACB | protein kinase cAMP-activat... | XM_017001719.1 | 69.1% | 68.3% | (many diffs) |
| 28 | human | 5567 | PRKACB | protein kinase cAMP-activat... | XM_017001712.2 | 69% | 69% | (many diffs) |
| 29 | human | 5567 | PRKACB | protein kinase cAMP-activat... | NM_001300917.2 | 69% | 68% | (many diffs) |
| 30 | human | 5567 | PRKACB | protein kinase cAMP-activat... | XM_017001720.1 | 68.9% | 68.6% | (many diffs) |
| 31 | human | 5567 | PRKACB | protein kinase cAMP-activat... | XM_017001706.1 | 68.8% | 67.8% | (many diffs) |
| 32 | human | 5567 | PRKACB | protein kinase cAMP-activat... | NM_001300915.2 | 68.6% | 68% | (many diffs) |
| 33 | human | 5567 | PRKACB | protein kinase cAMP-activat... | XM_017001707.1 | 68.6% | 68.1% | (many diffs) |
| 34 | human | 5567 | PRKACB | protein kinase cAMP-activat... | XM_017001708.2 | 68.5% | 68.3% | (many diffs) |
| 35 | human | 5567 | PRKACB | protein kinase cAMP-activat... | XM_005271020.2 | 62.9% | 61% | (many diffs) |
| 36 | human | 5567 | PRKACB | protein kinase cAMP-activat... | NM_001300916.2 | 62.7% | 61.3% | (many diffs) |
| 37 | mouse | 18749 | Prkacb | protein kinase, cAMP depend... | NM_011100.4 | 87.1% | 96% | (many diffs) |
| 38 | mouse | 18749 | Prkacb | protein kinase, cAMP depend... | NM_001164198.1 | 83.4% | 92.3% | (many diffs) |
| 39 | mouse | 18749 | Prkacb | protein kinase, cAMP depend... | NM_001164199.1 | 83.4% | 92% | (many diffs) |
| 40 | mouse | 18749 | Prkacb | protein kinase, cAMP depend... | NM_001164200.1 | 76% | 82.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1119
- ORF length:
- 1053
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg gaacgcggcg accgccaaga aaggcagcga ggtggagagc gtgaaagagt 121 ttctagccaa agccaaagaa gactttttga aaaaatggga gaatccaact cagaataatg 181 ccggacttga agattttgaa aggaaaaaaa cccttggaac aggttcattt ggaagagtca 241 tgttggtaaa acacaaagcc actgaacagt attatgccat gaagatctta gataagcaga 301 aggttgttaa actgaagcaa atagagcata ctttgaatga gaaaagaata ttacaggcag 361 tgaattttcc tttccttgtt cgactggagt atgcttttaa ggataattct aatttataca 421 tggttatgga atatgtccct gggggtgaaa tgttttcaca tctaagaaga attggaaggt 481 tcagtgagcc ccatgcacgg ttctatgcag ctcagatagt gctaacattc gagtacctca 541 attcactaga catcatctac agagatctaa aacctgaaaa tctcttaatt gaccatcaag 601 gctatatcca ggtcacagac tttgggtttg ccaaaagagt taaaggcaga acttggacat 661 tatgtggaac tccagagtat ttggctccag aaataattcT CAGCAAGGGC TACAATAAGG 721 CAGTGGATTG GTGGGCATTA GGAGTGCTAA TCTATGAAAT GGCAGCTGGC TATCCCCCAT 781 TCTTTGCAGA CCAACCAATT CAGATTTATG AAAAGATTGT TTCTGGAAAG GTCCGATTCC 841 CATCCAACTT CAGTTCAGAT CTCAAGGACC TTCTACGGAA CCTGCTGCAG GTGGATTTGA 901 CCAAGAGATT TGGAAATCTA AAGAATGGTG TCAGTGATAT AAAAACTCAC AAGTGGTTTG 961 CCACGACAGA TTGGATTGCT ATTTACCAGA GGAAGGTTGA AGCTCCATTC ATACCAAAGT 1021 TTAGAGGCTC TGGAGATACC AGCAACTTTG ATGACTATGA AGAAGAAGAT ATCCGTGTCT 1081 CTATAACAGA AAAATGTGCA AAAGAATTTG GTGAATTTTA CCCAACTTTC TTGTACAAAG 1141 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 1201 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 1261 ACGAAGTACG TGTTCTAGAG GGTTTGTAAC GCGTTAAGTC gacaatcaac ctctggatta 1321 caaaatttgt gaaagatt