Transcript: Human XM_005271015.3

PREDICTED: Homo sapiens protein kinase cAMP-activated catalytic subunit beta (PRKACB), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PRKACB (5567)
Length:
4451
CDS:
206..1258

Additional Resources:

NCBI RefSeq record:
XM_005271015.3
NBCI Gene record:
PRKACB (5567)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005271015.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002002 AGGAGTGCTAATCTATGAAAT pLKO.1 877 CDS 100% 13.200 18.480 N PRKACB n/a
2 TRCN0000002004 GCCAACTGACTTAACAACATT pLKO.1 2615 3UTR 100% 5.625 7.875 N PRKACB n/a
3 TRCN0000002006 CACGACAGATTGGATTGCTAT pLKO.1 1099 CDS 100% 4.950 6.930 N PRKACB n/a
4 TRCN0000002005 ACTCAGAATAATGCCGGACTT pLKO.1 305 CDS 100% 4.050 5.670 N PRKACB n/a
5 TRCN0000195126 CAGTAGTTATTGCCAATATTG pLKO.1 1648 3UTR 100% 13.200 9.240 N PRKACB n/a
6 TRCN0000195200 CCAGCATTTCTGTAGGTATTA pLKO.1 2041 3UTR 100% 13.200 9.240 N PRKACB n/a
7 TRCN0000195249 CCAGCAACTTTGATGACTATG pLKO.1 1176 CDS 100% 10.800 7.560 N PRKACB n/a
8 TRCN0000196664 GCTCAGATAGTGCTAACATTC pLKO.1 647 CDS 100% 10.800 7.560 N PRKACB n/a
9 TRCN0000196263 GAGCATACTTTGAATGAGAAA pLKO.1 461 CDS 100% 4.950 3.465 N PRKACB n/a
10 TRCN0000002003 CCTCCATTCACTAGACCTCAT pLKO.1 673 CDS 100% 4.050 2.835 N PRKACB n/a
11 TRCN0000194655 CTGAACAGTATTATGCCATGA pLKO.1 399 CDS 100% 4.050 2.835 N PRKACB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005271015.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06771 pDONR223 100% 94.9% 95.7% None (many diffs) n/a
2 ccsbBroad304_06771 pLX_304 63.7% 94.9% 95.7% V5 (many diffs) n/a
3 TRCN0000472524 AGTACGTGTTCTAGAGGGTTTGTA pLX_317 40% 94.9% 95.7% V5 (many diffs) n/a
4 ccsbBroadEn_14781 pDONR223 0% 94.9% 95.7% None (many diffs) n/a
5 ccsbBroad304_14781 pLX_304 18.9% 94.9% 95.7% V5 (many diffs) n/a
6 TRCN0000480324 TTTCTTACTCCGACTCGAACCGGA pLX_317 38.8% 94.9% 95.7% V5 (many diffs) n/a
7 ccsbBroadEn_01278 pDONR223 100% 68.8% 69.5% None (many diffs) n/a
8 ccsbBroad304_01278 pLX_304 86.8% 68.8% 69.5% V5 (many diffs) n/a
9 TRCN0000471379 CTTTCTAATGATGACAGCGATACC pLX_317 73.4% 68.6% 23.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV