Transcript: Human NM_182948.4

Homo sapiens protein kinase cAMP-activated catalytic subunit beta (PRKACB), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
PRKACB (5567)
Length:
4481
CDS:
92..1288

Additional Resources:

NCBI RefSeq record:
NM_182948.4
NBCI Gene record:
PRKACB (5567)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001145037 AAGCATACTCCAGTCGAACA pXPR_003 AGG 455 38% 4 0.5935 PRKACB PRKACB 75960
2 BRDN0001148118 GAAGATCTTAGATAAGCAGA pXPR_003 AGG 373 31% 3 0.4307 PRKACB PRKACB 75962
3 BRDN0001147109 TGTGAAAACATTTCACCCCC pXPR_003 AGG 519 43% 5 -0.4455 PRKACB PRKACB 75961
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_182948.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002002 AGGAGTGCTAATCTATGAAAT pLKO.1 907 CDS 100% 13.200 18.480 N PRKACB n/a
2 TRCN0000002004 GCCAACTGACTTAACAACATT pLKO.1 2645 3UTR 100% 5.625 7.875 N PRKACB n/a
3 TRCN0000002006 CACGACAGATTGGATTGCTAT pLKO.1 1129 CDS 100% 4.950 6.930 N PRKACB n/a
4 TRCN0000002005 ACTCAGAATAATGCCGGACTT pLKO.1 335 CDS 100% 4.050 5.670 N PRKACB n/a
5 TRCN0000195126 CAGTAGTTATTGCCAATATTG pLKO.1 1678 3UTR 100% 13.200 9.240 N PRKACB n/a
6 TRCN0000195200 CCAGCATTTCTGTAGGTATTA pLKO.1 2071 3UTR 100% 13.200 9.240 N PRKACB n/a
7 TRCN0000195249 CCAGCAACTTTGATGACTATG pLKO.1 1206 CDS 100% 10.800 7.560 N PRKACB n/a
8 TRCN0000196664 GCTCAGATAGTGCTAACATTC pLKO.1 677 CDS 100% 10.800 7.560 N PRKACB n/a
9 TRCN0000196263 GAGCATACTTTGAATGAGAAA pLKO.1 491 CDS 100% 4.950 3.465 N PRKACB n/a
10 TRCN0000002003 CCTCCATTCACTAGACCTCAT pLKO.1 703 CDS 100% 4.050 2.835 N PRKACB n/a
11 TRCN0000194655 CTGAACAGTATTATGCCATGA pLKO.1 429 CDS 100% 4.050 2.835 N PRKACB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_182948.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06771 pDONR223 100% 86.3% 84.6% None (many diffs) n/a
2 ccsbBroad304_06771 pLX_304 63.7% 86.3% 84.6% V5 (many diffs) n/a
3 TRCN0000472524 AGTACGTGTTCTAGAGGGTTTGTA pLX_317 40% 86.3% 84.6% V5 (many diffs) n/a
4 ccsbBroadEn_14781 pDONR223 0% 86.3% 84.6% None (many diffs) n/a
5 ccsbBroad304_14781 pLX_304 18.9% 86.3% 84.6% V5 (many diffs) n/a
6 TRCN0000480324 TTTCTTACTCCGACTCGAACCGGA pLX_317 38.8% 86.3% 84.6% V5 (many diffs) n/a
7 ccsbBroadEn_01278 pDONR223 100% 62.8% 61.5% None (many diffs) n/a
8 ccsbBroad304_01278 pLX_304 86.8% 62.8% 61.5% V5 (many diffs) n/a
9 TRCN0000471379 CTTTCTAATGATGACAGCGATACC pLX_317 73.4% 62.7% 21.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV