Transcript: Human XM_017001707.1

PREDICTED: Homo sapiens protein kinase cAMP-activated catalytic subunit beta (PRKACB), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PRKACB (5567)
Length:
1826
CDS:
225..1019

Additional Resources:

NCBI RefSeq record:
XM_017001707.1
NBCI Gene record:
PRKACB (5567)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017001707.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002002 AGGAGTGCTAATCTATGAAAT pLKO.1 920 CDS 100% 13.200 18.480 N PRKACB n/a
2 TRCN0000002005 ACTCAGAATAATGCCGGACTT pLKO.1 348 CDS 100% 4.050 5.670 N PRKACB n/a
3 TRCN0000196664 GCTCAGATAGTGCTAACATTC pLKO.1 690 CDS 100% 10.800 7.560 N PRKACB n/a
4 TRCN0000196263 GAGCATACTTTGAATGAGAAA pLKO.1 504 CDS 100% 4.950 3.465 N PRKACB n/a
5 TRCN0000002003 CCTCCATTCACTAGACCTCAT pLKO.1 716 CDS 100% 4.050 2.835 N PRKACB n/a
6 TRCN0000194655 CTGAACAGTATTATGCCATGA pLKO.1 442 CDS 100% 4.050 2.835 N PRKACB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017001707.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01278 pDONR223 100% 93.1% 93.1% None (many diffs) n/a
2 ccsbBroad304_01278 pLX_304 86.8% 93.1% 93.1% V5 (many diffs) n/a
3 TRCN0000471379 CTTTCTAATGATGACAGCGATACC pLX_317 73.4% 92.9% 32.1% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_06771 pDONR223 100% 68.6% 68.1% None (many diffs) n/a
5 ccsbBroad304_06771 pLX_304 63.7% 68.6% 68.1% V5 (many diffs) n/a
6 TRCN0000472524 AGTACGTGTTCTAGAGGGTTTGTA pLX_317 40% 68.6% 68.1% V5 (many diffs) n/a
7 ccsbBroadEn_14781 pDONR223 0% 68.6% 68.1% None (many diffs) n/a
8 ccsbBroad304_14781 pLX_304 18.9% 68.6% 68.1% V5 (many diffs) n/a
9 TRCN0000480324 TTTCTTACTCCGACTCGAACCGGA pLX_317 38.8% 68.6% 68.1% V5 (many diffs) n/a
Download CSV