Construct: ORF TRCN0000473797
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018821.2_s317c1
- Derived from:
- ccsbBroadEn_14755
- DNA Barcode:
- ACCTCCCCATTAAGACGTTATGAT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- PHKG1 (5260)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473797
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5260 | PHKG1 | phosphorylase kinase cataly... | NM_006213.4 | 99.7% | 34.8% | 383_384insA;387G>N;555C>T |
| 2 | human | 5260 | PHKG1 | phosphorylase kinase cataly... | NM_001258460.1 | 97.4% | 32.5% | (many diffs) |
| 3 | human | 5260 | PHKG1 | phosphorylase kinase cataly... | NM_001258459.1 | 92.1% | 32.2% | (many diffs) |
| 4 | human | 5260 | PHKG1 | phosphorylase kinase cataly... | XM_017012324.2 | 89.3% | 31.2% | (many diffs) |
| 5 | human | 5260 | PHKG1 | phosphorylase kinase cataly... | XM_005271772.5 | 79.6% | 14.7% | (many diffs) |
| 6 | human | 5260 | PHKG1 | phosphorylase kinase cataly... | XM_017012325.2 | 76.8% | 9% | (many diffs) |
| 7 | human | 5260 | PHKG1 | phosphorylase kinase cataly... | XM_017012326.2 | 71.3% | 13.1% | (many diffs) |
| 8 | human | 5260 | PHKG1 | phosphorylase kinase cataly... | XM_017012327.2 | 64.8% | 6.7% | (many diffs) |
| 9 | human | 5260 | PHKG1 | phosphorylase kinase cataly... | NR_047689.1 | 51.8% | (many diffs) | |
| 10 | mouse | 18682 | Phkg1 | phosphorylase kinase gamma 1 | NM_011079.3 | 87% | 32.4% | (many diffs) |
| 11 | mouse | 18682 | Phkg1 | phosphorylase kinase gamma 1 | XM_011240871.2 | 63.1% | 7.2% | (many diffs) |
| 12 | mouse | 18682 | Phkg1 | phosphorylase kinase gamma 1 | NR_145486.1 | 34.4% | (many diffs) | |
| 13 | mouse | 18682 | Phkg1 | phosphorylase kinase gamma 1 | NR_145487.1 | 34.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 546
- ORF length:
- 477
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gacccgggac gaggcactgc cggactctca ttctgcacag gacttctatg 121 agaattatga gcccaaagag atcctgggca ggggcgttag cagtgtggtc aggcgatgca 181 tccacaagcc cacgagccag gagtacgccg tgaaggtcat cgacgtcacc ggtggaggca 241 gcttcagccc ggaggaggtg cgggagctgc gagaagccac gctgaaggag gtggacatcc 301 tgcgcaaggt ctcagggcac cccaacatca tacagctgaa ggacacttat gagaccaaca 361 ctttcttctt cttggtgttt gacctgatga agagagggga gctctttgac tacctcactg 421 agaaggtcac cttgagtgag aaggaaacca gaaaanatca tgcgagctct gctggaggtg 481 atctgcacct tgcacaaact caacatcgtg caccgggacc tgaagcccga gaacattctc 541 ttggatgaca acatgaacat caagctcaca gactttggct tttcctgcca gctggagccg 601 ggagagaggc tgcgagaggt ctgtgggacc cccagttacc tggcccctga gattatcgag 661 tgctccatga atgaggacca cccgggctac gggaaagagg tggacatgtg gagcactggc 721 gtcatcatgt acacgctgct ggccggctcc ccgcccttct ggcaccggaa gcagatgctg 781 atgctgagga tgatcatgag cggcAACTAC CAGTTTGGCT CGCCCGAGTG GGATGATTAC 841 TCGGACACCG TGAAGGACCT GGTCTCCCGA TTCCTGGTGG TGCAACCCCA GAACCGCTAC 901 ACAGCGGAAG AGGCCTTGGC ACACCCCTTC TTCCAGCAGT ACTTGGTGGA GGAAGTGCGG 961 CACTTCAGCC CCCGGGGGAA GTTCAAGGTG ATCGCTCTGA CCGTGCTGGC TTCAGTGCGG 1021 ATCTACTACC AGTACCGCCG GGTGAAGCCT GTGACCCGGG AGATCGTCAT CCGAGACCCC 1081 TATGCCCTCC GGCCTCTGCG CCGGCTCATC GACGCCTACG CTTTCCGAAT CTATGGCCAC 1141 TGGGTGAAGA AGGGGCAGCA GCAGAACCGG GCAGCCCTTT TCGAGAACAC ACCCAAGGCC 1201 GTGCTCCTCT CCCTGGCCGA GGAGGACTAC TTGCCAACTT TCTTGTACAA AGTGGTTGAT 1261 ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT 1321 CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGAACCT 1381 CCCCATTAAG ACGTTATGAT ACGCGTTAAG TCgacaatca acctctggat tacaaaattt 1441 gtgaaagatt