Transcript: Mouse NM_201357.2

Mus musculus tumor suppressing subtransferable candidate 1 (Tssc1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Tssc1 (380752)
Length:
1692
CDS:
136..1296

Additional Resources:

NCBI RefSeq record:
NM_201357.2
NBCI Gene record:
Tssc1 (380752)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_201357.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042488 CCAGATATACTGCATAGAGAA pLKO.1 789 CDS 100% 4.950 6.930 N Tssc1 n/a
2 TRCN0000327327 CCAGATATACTGCATAGAGAA pLKO_005 789 CDS 100% 4.950 6.930 N Tssc1 n/a
3 TRCN0000042489 CCAAGGAATTAGAATCCGGTA pLKO.1 440 CDS 100% 2.160 3.024 N Tssc1 n/a
4 TRCN0000306662 ATCTGCAGCTACGAGGTAATT pLKO_005 1340 3UTR 100% 13.200 10.560 N Tssc1 n/a
5 TRCN0000306663 CCCTGCAGGACAACGTTATTG pLKO_005 1133 CDS 100% 13.200 9.240 N Tssc1 n/a
6 TRCN0000341020 GGGATGGGAAGAAGGTCATTT pLKO_005 572 CDS 100% 13.200 9.240 N Tssc1 n/a
7 TRCN0000038055 CGCAGTCTCTTAAATATGATA pLKO.1 236 CDS 100% 5.625 3.938 N EIPR1 n/a
8 TRCN0000299036 CGCAGTCTCTTAAATATGATA pLKO_005 236 CDS 100% 5.625 3.938 N EIPR1 n/a
9 TRCN0000042490 AGGGCACTGAAGTACCACATA pLKO.1 1267 CDS 100% 4.950 3.465 N Tssc1 n/a
10 TRCN0000042491 CAGATCCACATCATAGACTTT pLKO.1 259 CDS 100% 4.950 3.465 N Tssc1 n/a
11 TRCN0000327254 CAGATCCACATCATAGACTTT pLKO_005 259 CDS 100% 4.950 3.465 N Tssc1 n/a
12 TRCN0000042492 CATGGCTGTTTGCTTCCCTAA pLKO.1 1211 CDS 100% 4.050 2.835 N Tssc1 n/a
13 TRCN0000327252 CATGGCTGTTTGCTTCCCTAA pLKO_005 1211 CDS 100% 4.050 2.835 N Tssc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_201357.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01719 pDONR223 100% 87% 93% None (many diffs) n/a
2 ccsbBroad304_01719 pLX_304 0% 87% 93% V5 (many diffs) n/a
3 TRCN0000474729 TTAAACCGACAGCACAGGCCAGCC pLX_317 43.5% 87% 93% V5 (many diffs) n/a
Download CSV