Transcript: Human XM_011510385.2

PREDICTED: Homo sapiens EARP complex and GARP complex interacting protein 1 (EIPR1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EIPR1 (7260)
Length:
1750
CDS:
187..1386

Additional Resources:

NCBI RefSeq record:
XM_011510385.2
NBCI Gene record:
EIPR1 (7260)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011510385.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038054 GCGGGTGAAATCTGGCATATT pLKO.1 412 CDS 100% 13.200 18.480 N EIPR1 n/a
2 TRCN0000038057 CCTTGACTTTAATCCCAATAA pLKO.1 921 CDS 100% 13.200 9.240 N EIPR1 n/a
3 TRCN0000299104 CCTTGACTTTAATCCCAATAA pLKO_005 921 CDS 100% 13.200 9.240 N EIPR1 n/a
4 TRCN0000038055 CGCAGTCTCTTAAATATGATA pLKO.1 323 CDS 100% 5.625 3.938 N EIPR1 n/a
5 TRCN0000299036 CGCAGTCTCTTAAATATGATA pLKO_005 323 CDS 100% 5.625 3.938 N EIPR1 n/a
6 TRCN0000038058 CCAGATCTACTGCATAGAGAA pLKO.1 876 CDS 100% 4.950 3.465 N EIPR1 n/a
7 TRCN0000299034 CCAGATCTACTGCATAGAGAA pLKO_005 876 CDS 100% 4.950 3.465 N EIPR1 n/a
8 TRCN0000038056 CCTTTCCAACATGGTGTCCAT pLKO.1 1116 CDS 100% 2.640 1.848 N EIPR1 n/a
9 TRCN0000299033 CCTTTCCAACATGGTGTCCAT pLKO_005 1116 CDS 100% 2.640 1.848 N EIPR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011510385.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01719 pDONR223 100% 95.6% 93% None (many diffs) n/a
2 ccsbBroad304_01719 pLX_304 0% 95.6% 93% V5 (many diffs) n/a
3 TRCN0000474729 TTAAACCGACAGCACAGGCCAGCC pLX_317 43.5% 95.6% 93% V5 (many diffs) n/a
Download CSV