Construct: ORF TRCN0000474842
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004716.1_s317c1
- Derived from:
- ccsbBroadEn_02125
- DNA Barcode:
- GCGCCAGGTAGACTTACACACAGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PDLIM7 (9260)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474842
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9260 | PDLIM7 | PDZ and LIM domain 7 | NM_005451.5 | 100% | 100% | |
| 2 | human | 9260 | PDLIM7 | PDZ and LIM domain 7 | NM_203352.3 | 92.3% | 91.4% | (many diffs) |
| 3 | human | 9260 | PDLIM7 | PDZ and LIM domain 7 | XM_011534698.2 | 79.6% | 72.6% | 0_1ins160;118_119ins119 |
| 4 | human | 9260 | PDLIM7 | PDZ and LIM domain 7 | NR_103804.2 | 71.7% | 1_88del;659_857del;1659_1911del | |
| 5 | human | 9260 | PDLIM7 | PDZ and LIM domain 7 | XM_011534699.2 | 67.6% | 67.6% | 0_1ins444 |
| 6 | human | 9260 | PDLIM7 | PDZ and LIM domain 7 | NM_213636.2 | 46.1% | 43% | (many diffs) |
| 7 | mouse | 67399 | Pdlim7 | PDZ and LIM domain 7 | NM_001114088.2 | 88.5% | 93.8% | (many diffs) |
| 8 | mouse | 67399 | Pdlim7 | PDZ and LIM domain 7 | XM_006517344.3 | 82.2% | 86.8% | (many diffs) |
| 9 | mouse | 67399 | Pdlim7 | PDZ and LIM domain 7 | XM_006517345.3 | 60.4% | 64.1% | (many diffs) |
| 10 | mouse | 67399 | Pdlim7 | PDZ and LIM domain 7 | XM_006517346.3 | 60.4% | 64.1% | (many diffs) |
| 11 | mouse | 67399 | Pdlim7 | PDZ and LIM domain 7 | XM_011244558.2 | 60.4% | 64.1% | (many diffs) |
| 12 | mouse | 67399 | Pdlim7 | PDZ and LIM domain 7 | XM_011244559.2 | 60.4% | 64.1% | (many diffs) |
| 13 | mouse | 67399 | Pdlim7 | PDZ and LIM domain 7 | NM_001114087.2 | 40.9% | 39.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1437
- ORF length:
- 1371
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga ttccttcaaa gtagtgctgg aggggccagc accttggggc ttccggctgc 121 aagggggcaa ggacttcaat gtgcccctct ccatttcccg gctcactcct gggggcaaag 181 cggcgcaggc cggagtggcc gtgggtgact gggtgctgag catcgatggc gagaatgcgg 241 gtagcctcac acacatcgaa gctcagaaca agatccgggc ctgcggggag cgcctcagcc 301 tgggcctcag cagggcccag ccggttcaga gcaaaccgca gaaggcctcc gcccccgccg 361 cggaccctcc gcggtacacc tttgcaccca gcgtctccct caacaagacg gcccggccct 421 ttggggcgcc cccgcccgct gacagcgccc cgcagcagaa tggacagccg ctccgaccgc 481 tggtcccaga tgccagcaag cagcggctga tggagaacac agaggactgg cggccgcggc 541 cggggacagg ccagtcgcgt tccttccgca tccttgccca cctcacaggc accgagttca 601 tgcaagaccc ggatgaggag cacctgaaga aatcaagcca ggtgcccagg acagaagccc 661 cagccccagc ctcatctaca ccccaggagc cctggcctgg ccctaccgcc cccagcccta 721 ccagccgccc gccctgggct gtggaccctg cgtttgccga gcgctatgcc ccggacaaaa 781 cgagcacagt gctgacccgg cacagccagc cggccacgcc cacgccgctg cagagccgca 841 cctccattgt gcaggcagct gccggagggg tgccaggagg gggcagcaac aacggcaaga 901 ctcccgtgtg tcaccagtgc cacaaggTCA TCCGGGGCCG CTACCTGGTG GCGCTGGGCC 961 ACGCGTACCA CCCGGAGGAG TTTGTGTGTA GCCAGTGTGG GAAGGTCCTG GAAGAGGGTG 1021 GCTTCTTTGA GGAGAAGGGC GCCATCTTCT GCCCACCATG CTATGACGTG CGCTATGCAC 1081 CCAGCTGTGC CAAGTGCAAG AAGAAGATTA CAGGCGAGAT CATGCACGCC CTGAAGATGA 1141 CCTGGCACGT GCACTGCTTT ACCTGTGCTG CCTGCAAGAC GCCCATCCGG AACAGGGCCT 1201 TCTACATGGA GGAGGGCGTG CCCTATTGCG AGCGAGACTA TGAGAAGATG TTTGGCACGA 1261 AATGCCATGG CTGTGACTTC AAGATCGACG CTGGGGACCG CTTCCTGGAG GCCCTGGGCT 1321 TCAGCTGGCA TGACACCTGC TTCGTCTGTG CGATATGTCA GATCAACCTG GAAGGAAAGA 1381 CCTTCTACTC CAAGAAGGAC AGGCCTCTCT GCAAGAGCCA TGCCTTCTCT CATGTGTGCC 1441 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 1501 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 1561 ATATATCTTG TGGAAAGGAC GAGCGCCAGG TAGACTTACA CACAGTACGC GTTAAGTCga 1621 caatcaacct ctggattaca aaatttgtga aagatt