Transcript: Mouse XM_006517344.3

PREDICTED: Mus musculus PDZ and LIM domain 7 (Pdlim7), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pdlim7 (67399)
Length:
1626
CDS:
119..1390

Additional Resources:

NCBI RefSeq record:
XM_006517344.3
NBCI Gene record:
Pdlim7 (67399)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006517344.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322544 AGGTGCAGACCTCTGACAAAC pLKO_005 396 CDS 100% 10.800 14.040 N Pdlim7 n/a
2 TRCN0000322470 GGAGACTGGGTACTGAATATT pLKO_005 257 CDS 100% 15.000 12.000 N Pdlim7 n/a
3 TRCN0000375191 GTTCATGCAAGACCCGGATGA pLKO_005 547 CDS 100% 4.050 3.240 N Pdlim7 n/a
4 TRCN0000159220 CGAGACTATGAGAAGATGTTT pLKO.1 1184 CDS 100% 5.625 3.938 N PDLIM7 n/a
5 TRCN0000200375 GCAGACCTCTGACAAACAGTT pLKO.1 400 CDS 100% 4.950 3.465 N Pdlim7 n/a
6 TRCN0000161061 GCGAGACTATGAGAAGATGTT pLKO.1 1183 CDS 100% 4.950 3.465 N PDLIM7 n/a
7 TRCN0000323379 GCGAGACTATGAGAAGATGTT pLKO_005 1183 CDS 100% 4.950 3.465 N PDLIM7 n/a
8 TRCN0000182783 CAGACCTCTGACAAACAGTTG pLKO.1 401 CDS 100% 4.050 2.835 N Pdlim7 n/a
9 TRCN0000375190 CTGATGGAGGATACCGAAGAC pLKO_005 458 CDS 100% 4.050 2.835 N Pdlim7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006517344.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02125 pDONR223 100% 82.2% 86.8% None (many diffs) n/a
2 ccsbBroad304_02125 pLX_304 0% 82.2% 86.8% V5 (many diffs) n/a
3 TRCN0000474842 GCGCCAGGTAGACTTACACACAGT pLX_317 37.3% 82.2% 86.8% V5 (many diffs) n/a
4 ccsbBroadEn_11354 pDONR223 100% 30.4% 31.7% None (many diffs) n/a
5 ccsbBroad304_11354 pLX_304 0% 30.4% 31.7% V5 (many diffs) n/a
6 TRCN0000472937 ACAAGGGCGCAACGTACTCCCCAT pLX_317 57.8% 30.4% 31.7% V5 (many diffs) n/a
Download CSV