Construct: ORF TRCN0000475548
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012110.1_s317c1
- Derived from:
- ccsbBroadEn_04170
- DNA Barcode:
- TGAACATATCATCATGGGACCTAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PANK2 (80025)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475548
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 80025 | PANK2 | pantothenate kinase 2 | NM_001324191.2 | 100% | 100% | |
2 | human | 80025 | PANK2 | pantothenate kinase 2 | NM_024960.6 | 100% | 100% | |
3 | human | 80025 | PANK2 | pantothenate kinase 2 | NM_153640.3 | 100% | 100% | |
4 | human | 80025 | PANK2 | pantothenate kinase 2 | XM_005260836.4 | 100% | 100% | |
5 | human | 80025 | PANK2 | pantothenate kinase 2 | XM_005260835.3 | 76.4% | 76.4% | 1_258del |
6 | human | 80025 | PANK2 | pantothenate kinase 2 | NM_153638.3 | 48.9% | 48.9% | 1_873del |
7 | human | 80025 | PANK2 | pantothenate kinase 2 | NM_001324193.2 | 48% | 48% | 0_1ins435 |
8 | human | 80025 | PANK2 | pantothenate kinase 2 | XM_017028077.2 | 48% | 48% | 0_1ins435 |
9 | human | 80025 | PANK2 | pantothenate kinase 2 | XM_017028078.2 | 48% | 48% | 0_1ins435 |
10 | human | 80025 | PANK2 | pantothenate kinase 2 | XM_017028079.2 | 48% | 48% | 0_1ins435 |
11 | human | 80025 | PANK2 | pantothenate kinase 2 | XM_024452002.1 | 48% | 48% | 0_1ins435 |
12 | human | 80025 | PANK2 | pantothenate kinase 2 | XM_011529364.3 | 38.5% | 38.5% | 1_873del;1233_1234ins177 |
13 | human | 80025 | PANK2 | pantothenate kinase 2 | NR_136715.2 | 10.1% | (many diffs) | |
14 | human | 80025 | PANK2 | pantothenate kinase 2 | XR_002958533.1 | 6.8% | 1_1034del;1143_1769del;2499_12294del | |
15 | mouse | 74450 | Pank2 | pantothenate kinase 2 | XM_006500298.3 | 92.3% | 98.2% | (many diffs) |
16 | mouse | 74450 | Pank2 | pantothenate kinase 2 | XM_006500299.3 | 92.3% | 98.2% | (many diffs) |
17 | mouse | 74450 | Pank2 | pantothenate kinase 2 | XM_017319298.1 | 92.3% | 98.2% | (many diffs) |
18 | mouse | 74450 | Pank2 | pantothenate kinase 2 | XM_017319299.1 | 63.7% | 57.1% | (many diffs) |
19 | mouse | 74450 | Pank2 | pantothenate kinase 2 | NM_153501.2 | 58.1% | 61.8% | (many diffs) |
20 | mouse | 74450 | Pank2 | pantothenate kinase 2 | XM_017319300.1 | 43.4% | 47.3% | (many diffs) |
21 | mouse | 74450 | Pank2 | pantothenate kinase 2 | XR_001783191.1 | 17.5% | (many diffs) | |
22 | mouse | 74450 | Pank2 | pantothenate kinase 2 | XR_001783192.1 | 15.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 906
- ORF length:
- 837
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gcctgctttt attcaaatgg gcagagataa aaacttctcg agtctccaca 121 ctgtcttttg tgccactgga ggtggagcgt acaaatttga gcaggatttt ctcacaatag 181 gtgatcttca gctttgcaaa ctggatgaac tagattgctt gatcaaagga attttataca 241 ttgactcagt cggattcaat ggacggtcac agtgctatta ctttgaaaac cctgctgatt 301 ctgaaaagtg tcagaagtta ccatttgatt tgaaaaatcc gtatcctctg cttctggtga 361 acattggctc aggggttagc atcttagcag tatattccaa agataattac aaacgggtca 421 caggtactag tcttggagga ggaacttttt ttggtctctg ctgtcttctt actggctgta 481 ccacttttga agaagctctt gaaatggcat ctcgtggaga tagcaccaaa gtggataaac 541 tagtacgaga tatttatgga ggggactatg agaggtttgg actgccaggc tgggctgtgg 601 cttcaagctt tGGAAACATG ATGAGCAAGG AGAAGCGAGA GGCTGTCAGT AAAGAGGACC 661 TGGCCAGAGC GACTTTGATC ACCATCACCA ACAACATTGG CTCAATAGCA AGAATGTGTG 721 CCCTTAATGA AAACATTAAC CAGGTGGTAT TTGTTGGAAA TTTCTTGAGA ATTAATACGA 781 TCGCCATGCG GCTTTTGGCA TATGCTTTGG ATTATTGGTC CAAGGGGCAG TTGAAAGCAC 841 TTTTTTCGGA ACACGAGGGT TATTTTGGAG CTGTTGGAGC ACTCCTTGAG CTGTTGAAGA 901 TCCCGTTGCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 961 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1021 CTTGGCTTTA TATATCTTGT GGAAAGGACG ATGAACATAT CATCATGGGA CCTATACGCG 1081 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt