Transcript: Human XM_005260836.4

PREDICTED: Homo sapiens pantothenate kinase 2 (PANK2), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PANK2 (80025)
Length:
1657
CDS:
314..1153

Additional Resources:

NCBI RefSeq record:
XM_005260836.4
NBCI Gene record:
PANK2 (80025)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005260836.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219836 CAGGCTACTATGCGTTATAAT pLKO.1 1523 3UTR 100% 15.000 21.000 N PANK2 n/a
2 TRCN0000037737 CGTACAAATTTGAGCAGGATT pLKO.1 393 CDS 100% 4.950 6.930 N PANK2 n/a
3 TRCN0000195447 CATTGACTCAGTCGGATTCAA pLKO.1 484 CDS 100% 5.625 4.500 N PANK2 n/a
4 TRCN0000025589 GCAAAGGCAATCTGCACTTTA pLKO.1 273 5UTR 100% 13.200 9.240 N Pank2 n/a
5 TRCN0000219835 GGGATCTGTGGACTTTCATTT pLKO.1 1192 3UTR 100% 13.200 9.240 N PANK2 n/a
6 TRCN0000037735 CCTCTGCTTCTGGTGAACATT pLKO.1 590 CDS 100% 5.625 3.938 N PANK2 n/a
7 TRCN0000037738 GCAAACTGGATGAACTAGATT pLKO.1 441 CDS 100% 5.625 3.938 N PANK2 n/a
8 TRCN0000037736 CCAGGTGGTATTTGTTGGAAA pLKO.1 985 CDS 100% 4.950 3.465 N PANK2 n/a
9 TRCN0000037734 GCTGTCTTCTTACTGGCTGTA pLKO.1 705 CDS 100% 4.050 2.835 N PANK2 n/a
10 TRCN0000196391 GATAATTACAAACGGGTCACA pLKO.1 647 CDS 100% 2.640 1.848 N PANK2 n/a
11 TRCN0000195677 CCAACAACATTGGCTCAATAG pLKO.1 933 CDS 100% 10.800 6.480 N PANK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005260836.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04170 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04170 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475548 TGAACATATCATCATGGGACCTAT pLX_317 35.4% 100% 100% V5 n/a
4 ccsbBroadEn_12663 pDONR223 100% 48% 48% None 1_435del n/a
5 ccsbBroad304_12663 pLX_304 0% 48% 48% V5 1_435del n/a
6 TRCN0000474214 GCCATTGCAGGTTATACACAAGAA pLX_317 100% 48% 48% V5 1_435del n/a
7 ccsbBroadEn_15160 pDONR223 0% 48% 48% None 1_435del n/a
8 ccsbBroad304_15160 pLX_304 0% 48% 48% V5 1_435del n/a
9 TRCN0000475199 TTCCACCGTCTCTGGCTTCGCAAT pLX_317 100% 48% 48% V5 1_435del n/a
Download CSV