Transcript: Mouse XM_017319300.1

PREDICTED: Mus musculus pantothenate kinase 2 (Pank2), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pank2 (74450)
Length:
3730
CDS:
461..865

Additional Resources:

NCBI RefSeq record:
XM_017319300.1
NBCI Gene record:
Pank2 (74450)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319300.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000378466 TTCCGAGCACGAGGGATATTT pLKO_005 802 CDS 100% 15.000 21.000 N Pank2 n/a
2 TRCN0000361874 ATGATCGTGTACTACTCAAAT pLKO_005 948 3UTR 100% 13.200 18.480 N Pank2 n/a
3 TRCN0000361876 GGTCGTATTTGTCGGCAATTT pLKO_005 700 CDS 100% 13.200 18.480 N Pank2 n/a
4 TRCN0000025590 CGGCAATTTCCTGAGAGTCAA pLKO.1 712 CDS 100% 4.950 3.960 N Pank2 n/a
5 TRCN0000361875 TATTCTCAGGGCAGCGTTATT pLKO_005 1085 3UTR 100% 13.200 9.240 N Pank2 n/a
6 TRCN0000025591 GACAAATTAGTTCGAGACATT pLKO.1 491 CDS 100% 4.950 3.465 N Pank2 n/a
7 TRCN0000037734 GCTGTCTTCTTACTGGCTGTA pLKO.1 417 5UTR 100% 4.050 2.835 N PANK2 n/a
8 TRCN0000025592 GCGGCCAGTAAGGAGGATCTT pLKO.1 599 CDS 100% 1.650 1.155 N Pank2 n/a
9 TRCN0000037735 CCTCTGCTTCTGGTGAACATT pLKO.1 302 5UTR 100% 5.625 3.938 N PANK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319300.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12663 pDONR223 100% 90.3% 98.5% None (many diffs) n/a
2 ccsbBroad304_12663 pLX_304 0% 90.3% 98.5% V5 (many diffs) n/a
3 TRCN0000474214 GCCATTGCAGGTTATACACAAGAA pLX_317 100% 90.3% 98.5% V5 (many diffs) n/a
4 ccsbBroadEn_15160 pDONR223 0% 90.3% 98.5% None (many diffs) n/a
5 ccsbBroad304_15160 pLX_304 0% 90.3% 98.5% V5 (many diffs) n/a
6 TRCN0000475199 TTCCACCGTCTCTGGCTTCGCAAT pLX_317 100% 90.3% 98.5% V5 (many diffs) n/a
7 ccsbBroadEn_04170 pDONR223 100% 43.4% 47.3% None (many diffs) n/a
8 ccsbBroad304_04170 pLX_304 0% 43.4% 47.3% V5 (many diffs) n/a
9 TRCN0000475548 TGAACATATCATCATGGGACCTAT pLX_317 35.4% 43.4% 47.3% V5 (many diffs) n/a
Download CSV