Transcript: Human XR_002958533.1

PREDICTED: Homo sapiens pantothenate kinase 2 (PANK2), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PANK2 (80025)
Length:
12294
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002958533.1
NBCI Gene record:
PANK2 (80025)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002958533.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219836 CAGGCTACTATGCGTTATAAT pLKO.1 2871 3UTR 100% 15.000 21.000 N PANK2 n/a
2 TRCN0000037737 CGTACAAATTTGAGCAGGATT pLKO.1 1114 3UTR 100% 4.950 6.930 N PANK2 n/a
3 TRCN0000195447 CATTGACTCAGTCGGATTCAA pLKO.1 1832 3UTR 100% 5.625 4.500 N PANK2 n/a
4 TRCN0000025589 GCAAAGGCAATCTGCACTTTA pLKO.1 994 3UTR 100% 13.200 9.240 N Pank2 n/a
5 TRCN0000219835 GGGATCTGTGGACTTTCATTT pLKO.1 2540 3UTR 100% 13.200 9.240 N PANK2 n/a
6 TRCN0000037735 CCTCTGCTTCTGGTGAACATT pLKO.1 1938 3UTR 100% 5.625 3.938 N PANK2 n/a
7 TRCN0000037738 GCAAACTGGATGAACTAGATT pLKO.1 1789 3UTR 100% 5.625 3.938 N PANK2 n/a
8 TRCN0000037736 CCAGGTGGTATTTGTTGGAAA pLKO.1 2333 3UTR 100% 4.950 3.465 N PANK2 n/a
9 TRCN0000037734 GCTGTCTTCTTACTGGCTGTA pLKO.1 2053 3UTR 100% 4.050 2.835 N PANK2 n/a
10 TRCN0000196391 GATAATTACAAACGGGTCACA pLKO.1 1995 3UTR 100% 2.640 1.848 N PANK2 n/a
11 TRCN0000195677 CCAACAACATTGGCTCAATAG pLKO.1 2281 3UTR 100% 10.800 6.480 N PANK2 n/a
12 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 7702 3UTR 100% 4.950 2.475 Y ERAP2 n/a
13 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 5885 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002958533.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04170 pDONR223 100% 6.8% None 1_1034del;1143_1769del;2499_12294del n/a
2 ccsbBroad304_04170 pLX_304 0% 6.8% V5 1_1034del;1143_1769del;2499_12294del n/a
3 TRCN0000475548 TGAACATATCATCATGGGACCTAT pLX_317 35.4% 6.8% V5 1_1034del;1143_1769del;2499_12294del n/a
4 ccsbBroadEn_12663 pDONR223 100% 3.2% None 1_2096del;2499_12294del n/a
5 ccsbBroad304_12663 pLX_304 0% 3.2% V5 1_2096del;2499_12294del n/a
6 TRCN0000474214 GCCATTGCAGGTTATACACAAGAA pLX_317 100% 3.2% V5 1_2096del;2499_12294del n/a
7 ccsbBroadEn_15160 pDONR223 0% 3.2% None 1_2096del;2499_12294del n/a
8 ccsbBroad304_15160 pLX_304 0% 3.2% V5 1_2096del;2499_12294del n/a
9 TRCN0000475199 TTCCACCGTCTCTGGCTTCGCAAT pLX_317 100% 3.2% V5 1_2096del;2499_12294del n/a
10 ccsbBroadEn_13781 pDONR223 100% 1.9% None (many diffs) n/a
11 ccsbBroad304_13781 pLX_304 0% 1.9% V5 (many diffs) n/a
12 TRCN0000469746 TCCCTGCGCCGTCCGGGTTTTCGA pLX_317 100% 1.9% V5 (many diffs) n/a
Download CSV