Construct: ORF TRCN0000475668
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008357.1_s317c1
- Derived from:
- ccsbBroadEn_13656
- DNA Barcode:
- ACATTGGCACGGGTCGTGATGCCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SPDYE8P (389517)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475668
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 100996746 | SPDYE11 | speedy/RINGO cell cycle reg... | NM_001351349.1 | 100% | 100% | |
| 2 | human | 102723849 | SPDYE17 | speedy/RINGO cell cycle reg... | NM_001351351.1 | 100% | 100% | |
| 3 | human | 100505767 | SPDYE18 | speedy/RINGO cell cycle reg... | NM_001351348.1 | 87.6% | 78.5% | (many diffs) |
| 4 | human | 100996746 | SPDYE11 | speedy/RINGO cell cycle reg... | XM_024446630.1 | 84.3% | 77.5% | 737_858del;918_942del |
| 5 | human | 102723555 | SPDYE16 | speedy/RINGO cell cycle reg... | NM_001351597.1 | 73.7% | 61.8% | (many diffs) |
| 6 | human | 102723555 | SPDYE16 | speedy/RINGO cell cycle reg... | XM_017012887.2 | 73.7% | 61.8% | (many diffs) |
| 7 | human | 285955 | SPDYE1 | speedy/RINGO cell cycle reg... | XM_017012016.2 | 73.6% | 64.1% | (many diffs) |
| 8 | human | 388333 | SPDYE4 | speedy/RINGO cell cycle reg... | NM_001128076.3 | 72.2% | 62.2% | (many diffs) |
| 9 | human | 388333 | SPDYE4 | speedy/RINGO cell cycle reg... | XM_005256633.4 | 72.2% | 62.2% | (many diffs) |
| 10 | human | 285955 | SPDYE1 | speedy/RINGO cell cycle reg... | NM_175064.2 | 67.3% | 56.1% | (many diffs) |
| 11 | human | 285955 | SPDYE1 | speedy/RINGO cell cycle reg... | XM_005249719.3 | 65.1% | 59.3% | (many diffs) |
| 12 | human | 285955 | SPDYE1 | speedy/RINGO cell cycle reg... | XM_017012015.1 | 65.1% | 59.3% | (many diffs) |
| 13 | human | 441273 | SPDYE2 | speedy/RINGO cell cycle reg... | NM_001031618.3 | 61% | 55.9% | (many diffs) |
| 14 | human | 100310812 | SPDYE2B | speedy/RINGO cell cycle reg... | NM_001166339.1 | 61% | 55.9% | (many diffs) |
| 15 | human | 100310812 | SPDYE2B | speedy/RINGO cell cycle reg... | XM_005250093.4 | 61% | 55.9% | (many diffs) |
| 16 | human | 441273 | SPDYE2 | speedy/RINGO cell cycle reg... | XM_017012223.1 | 61% | 55.9% | (many diffs) |
| 17 | human | 729597 | SPDYE6 | speedy/RINGO cell cycle reg... | NM_001146210.4 | 60.9% | 55.9% | (many diffs) |
| 18 | human | 442590 | SPDYE5 | speedy/RINGO cell cycle reg... | NM_001306141.1 | 60.8% | 55.9% | (many diffs) |
| 19 | human | 441251 | SPDYE7P | speedy/RINGO cell cycle reg... | NR_003666.2 | 59.3% | (many diffs) | |
| 20 | human | 285955 | SPDYE1 | speedy/RINGO cell cycle reg... | XM_017012017.2 | 58.7% | 53% | (many diffs) |
| 21 | human | 100310812 | SPDYE2B | speedy/RINGO cell cycle reg... | XM_011515702.3 | 57.1% | 51.1% | (many diffs) |
| 22 | human | 441273 | SPDYE2 | speedy/RINGO cell cycle reg... | XM_011516237.3 | 57.1% | 51.1% | (many diffs) |
| 23 | human | 441272 | SPDYE3 | speedy/RINGO cell cycle reg... | NM_001004351.5 | 44.3% | 43.2% | (many diffs) |
| 24 | human | 441272 | SPDYE3 | speedy/RINGO cell cycle reg... | XM_011516234.3 | 40.7% | 36.6% | (many diffs) |
| 25 | human | 441272 | SPDYE3 | speedy/RINGO cell cycle reg... | XM_011516235.3 | 40.7% | 36.6% | (many diffs) |
| 26 | human | 641776 | SPDYE14P | speedy/RINGO cell cycle reg... | NR_146072.1 | 34% | 1_200del;319T>C;996_2332del | |
| 27 | human | 105180390 | SPDYE13P | speedy/RINGO cell cycle reg... | NR_146073.1 | 34% | 1_200del;319T>C;996_2332del | |
| 28 | human | 105180391 | SPDYE15P | speedy/RINGO cell cycle reg... | NR_146074.1 | 34% | 1_200del;319T>C;996_2332del | |
| 29 | human | 728524 | SPDYE8P | speedy/RINGO cell cycle reg... | NR_003664.2 | 27.5% | 1_571del;1367_2884del | |
| 30 | human | 643862 | SPDYE10P | speedy/RINGO cell cycle reg... | NR_146079.1 | 27.2% | 1_1155del;1341A>G;1951_2918del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 864
- ORF length:
- 795
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gggacagatt ttgggaaaga tcatgatgag ccatcaaccg cagccccagg 121 aagagcggag cccccagcgg agcacctcag ggtaccccct ccaggaggtg gtggatgatg 181 aagtgtcggg accatcagcc cctggggtag atcccagccc cccacgtagg tcccttggct 241 ggaaaaggaa gagggaatgt ttggatgaat ctgatgatga gccagagaag gagctcgccc 301 ctgagcctga ggagacctgg gtggcggaga cgctgtgtgg cctcaagatg aaggcgaagc 361 gacggcgagt gtcgctcgtg ctccctgagt actacgaggc cttcaacagg ctgcttgagg 421 atcctgtcat taaaagactc ctggcctggg acaaagatct gagggtgtcg gacaagtatc 481 tcctggctat ggtcatagcg tatttcagcc gggccggcct cccctcctgg caataccaac 541 gcattcattt cttcctggct ctctatctgg ccaatgacat ggaggaggac gacgaggccc 601 ccaaacaaaa catcttctac ttcctgtacg aggagacccg ctctcatata cccttgctca 661 gtgagctttg gttccagtta tgccgttaca tgaacccgag ggccaggaag aactgctctc 721 agatagcctt gttccggaag tatcggttcc acttcttttg ttccatgcgc tgcagggctt 781 gggtttccct ggaggagttg gaagagatcc aggcttatga cccagagcac tgggtgtggg 841 cgcGAGATCG CGCCCACCTT TCCTTGCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 901 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 961 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAA CATTGGCACG 1021 GGTCGTGATG CCTACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1081 att