Transcript: Human XM_011516235.3

PREDICTED: Homo sapiens speedy/RINGO cell cycle regulator family member E3 (SPDYE3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPDYE3 (441272)
Length:
2990
CDS:
1089..2885

Additional Resources:

NCBI RefSeq record:
XM_011516235.3
NBCI Gene record:
SPDYE3 (441272)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011516235.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000167638 GAACTTTATTCCAGTGCTAAT pLKO.1 2942 3UTR 100% 10.800 6.480 N SPDYE3 n/a
2 TRCN0000173057 CTTCTACTTCCTGTACGGGAA pLKO.1 2486 CDS 100% 2.160 1.296 N SPDYE3 n/a
3 TRCN0000256763 CTTGAGGATCCTGTCATTAAA pLKO_005 2286 CDS 100% 15.000 7.500 Y SPDYE5 n/a
4 TRCN0000161349 GCAATACCAACGCATTCATTT pLKO.1 2402 CDS 100% 13.200 6.600 Y SPDYE2 n/a
5 TRCN0000149464 GCTTGAGGATCCTGTCATTAA pLKO.1 2285 CDS 100% 13.200 6.600 Y SPDYE7P n/a
6 TRCN0000163014 GCTTGAGGATCCTGTCATTAA pLKO.1 2285 CDS 100% 13.200 6.600 Y SPDYE2 n/a
7 TRCN0000337263 TGCTTGAGGATCCTGTCATTA pLKO_005 2284 CDS 100% 13.200 6.600 Y SPDYE6 n/a
8 TRCN0000256760 ATCTCCTGGCTATGGTCATAG pLKO_005 2350 CDS 100% 10.800 5.400 Y SPDYE5 n/a
9 TRCN0000337326 CAATACCAACGCATTCATTTC pLKO_005 2403 CDS 100% 10.800 5.400 Y SPDYE6 n/a
10 TRCN0000172268 CTGAGGGTGTCAGACAAGTAT pLKO.1 2331 CDS 100% 5.625 2.813 Y SPDYE3 n/a
11 TRCN0000166211 CAGGAAGAACTGCTCTCAGAT pLKO.1 2576 CDS 100% 4.950 2.475 Y SPDYE8P n/a
12 TRCN0000164079 CATTTCTTCCTGGCTCTCTAT pLKO.1 2418 CDS 100% 4.950 2.475 Y SPDYE8P n/a
13 TRCN0000172267 CTGCTTGAGGATCCTGTCATT pLKO.1 2283 CDS 100% 4.950 2.475 Y SPDYE3 n/a
14 TRCN0000148971 GTTCCAGTTCTTCTGTTCCAT pLKO.1 2618 CDS 100% 3.000 1.500 Y SPDYE7P n/a
15 TRCN0000173032 CAGACAAGTATCTCCTGGCTA pLKO.1 2341 CDS 100% 2.640 1.320 Y SPDYE3 n/a
16 TRCN0000172603 GAACTGCTCTCAGATAGCCTT pLKO.1 2582 CDS 100% 2.640 1.320 Y SPDYE3 n/a
17 TRCN0000122621 GCTTCAAGCTTTGAGTGGAGA pLKO.1 659 5UTR 100% 2.640 1.320 Y SPDYE12P n/a
18 TRCN0000148586 CATTCATTTCTTCCTGGCTCT pLKO.1 2414 CDS 100% 2.160 1.080 Y SPDYE7P n/a
19 TRCN0000163412 GATGAATCTGATGATGAGCCA pLKO.1 1260 CDS 100% 0.660 0.330 Y SPDYE8P n/a
20 TRCN0000166602 CTGGCTATGGTCATAGCGTAT pLKO.1 2355 CDS 100% 0.405 0.203 Y SPDYE2 n/a
21 TRCN0000337319 GGAGGTGGTGGATGATGAAAT pLKO_005 1160 CDS 100% 13.200 6.600 Y SPDYE6 n/a
22 TRCN0000129780 CAGCAGGAACTTTATTCCAAT pLKO.1 2936 3UTR 100% 4.950 2.475 Y SPDYE7P n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011516235.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13656 pDONR223 100% 40.7% 36.6% None (many diffs) n/a
2 ccsbBroad304_13656 pLX_304 0% 40.7% 36.6% V5 (many diffs) n/a
3 TRCN0000475668 ACATTGGCACGGGTCGTGATGCCT pLX_317 3.7% 40.7% 36.6% V5 (many diffs) n/a
4 ccsbBroadEn_13699 pDONR223 100% 32.3% 23.7% None (many diffs) n/a
5 ccsbBroad304_13699 pLX_304 0% 32.3% 23.7% V5 (many diffs) n/a
6 TRCN0000491865 TCAAGTGTCGATCAACATATTAAG pLX_317 45.6% 32.3% 23.7% V5 (many diffs) n/a
7 ccsbBroadEn_13698 pDONR223 100% 31.6% 25.9% None (many diffs) n/a
8 ccsbBroad304_13698 pLX_304 0% 31.6% 25.9% V5 (many diffs) n/a
9 TRCN0000479788 CGCTCTCGGCAACTTCTTGCATGC pLX_317 57.1% 31.6% 25.9% V5 (many diffs) n/a
Download CSV