Transcript: Human XM_017012223.1

PREDICTED: Homo sapiens speedy/RINGO cell cycle regulator family member E2 (SPDYE2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPDYE2 (441273)
Length:
4899
CDS:
474..1682

Additional Resources:

NCBI RefSeq record:
XM_017012223.1
NBCI Gene record:
SPDYE2 (441273)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012223.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000256763 CTTGAGGATCCTGTCATTAAA pLKO_005 1080 CDS 100% 15.000 7.500 Y SPDYE5 n/a
2 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 4513 3UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
3 TRCN0000161349 GCAATACCAACGCATTCATTT pLKO.1 1196 CDS 100% 13.200 6.600 Y SPDYE2 n/a
4 TRCN0000149464 GCTTGAGGATCCTGTCATTAA pLKO.1 1079 CDS 100% 13.200 6.600 Y SPDYE7P n/a
5 TRCN0000163014 GCTTGAGGATCCTGTCATTAA pLKO.1 1079 CDS 100% 13.200 6.600 Y SPDYE2 n/a
6 TRCN0000337319 GGAGGTGGTGGATGATGAAAT pLKO_005 599 CDS 100% 13.200 6.600 Y SPDYE6 n/a
7 TRCN0000337318 TAAGCGTCGGTTCCAGTTATA pLKO_005 1403 CDS 100% 13.200 6.600 Y SPDYE6 n/a
8 TRCN0000337263 TGCTTGAGGATCCTGTCATTA pLKO_005 1078 CDS 100% 13.200 6.600 Y SPDYE6 n/a
9 TRCN0000337262 ACTTGCAGTCCAGGAGGATTT pLKO_005 2056 3UTR 100% 10.800 5.400 Y SPDYE6 n/a
10 TRCN0000256762 AGATAGTCCTGTTCCAGAAAC pLKO_005 1537 CDS 100% 10.800 5.400 Y SPDYE5 n/a
11 TRCN0000256760 ATCTCCTGGCTATGGTCATAG pLKO_005 1144 CDS 100% 10.800 5.400 Y SPDYE5 n/a
12 TRCN0000337326 CAATACCAACGCATTCATTTC pLKO_005 1197 CDS 100% 10.800 5.400 Y SPDYE6 n/a
13 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 4617 3UTR 100% 10.800 5.400 Y MRPS16 n/a
14 TRCN0000427607 TGAGGGTGTCGGACAAGTATC pLKO_005 1126 CDS 100% 10.800 5.400 Y SPDYE1 n/a
15 TRCN0000148587 CAGATAGTCCTGTTCCAGAAA pLKO.1 1536 CDS 100% 4.950 2.475 Y SPDYE7P n/a
16 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 3962 3UTR 100% 4.950 2.475 Y ORAI2 n/a
17 TRCN0000163830 CCATTCTTGATGGAGCTGAAT pLKO.1 1844 3UTR 100% 4.950 2.475 Y SPDYE1 n/a
18 TRCN0000172267 CTGCTTGAGGATCCTGTCATT pLKO.1 1077 CDS 100% 4.950 2.475 Y SPDYE3 n/a
19 TRCN0000162985 GAGACAAGGTTTCACCATGTT pLKO.1 3706 3UTR 100% 4.950 2.475 Y LINC00336 n/a
20 TRCN0000159863 GTTTCTATAAAGCTGTGTGAT pLKO.1 2771 3UTR 100% 4.950 2.475 Y SPDYE1 n/a
21 TRCN0000162782 CTCAAGATGAAGCTGAAGCAA pLKO.1 777 CDS 100% 3.000 1.500 Y SPDYE1 n/a
22 TRCN0000163638 GTTCCAGTTATACCGTTCCAT pLKO.1 1487 CDS 100% 3.000 1.500 Y SPDYE2 n/a
23 TRCN0000166235 CCACAAGGACTTCAACAGTCA pLKO.1 827 CDS 100% 2.640 1.320 Y SPDYE1 n/a
24 TRCN0000166723 CCAGTTATACCGTTCCACGAA pLKO.1 1415 CDS 100% 2.640 1.320 Y SPDYE2 n/a
25 TRCN0000148586 CATTCATTTCTTCCTGGCTCT pLKO.1 1208 CDS 100% 2.160 1.080 Y SPDYE7P n/a
26 TRCN0000166690 CTCAAGATGAAGCTGAAGCGA pLKO.1 1008 CDS 100% 0.750 0.375 Y SPDYE2 n/a
27 TRCN0000164154 CCACTTCCTGTATAGGAAGAA pLKO.1 1283 CDS 100% 0.495 0.248 Y SPDYE2 n/a
28 TRCN0000166602 CTGGCTATGGTCATAGCGTAT pLKO.1 1149 CDS 100% 0.405 0.203 Y SPDYE2 n/a
29 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 4617 3UTR 100% 10.800 5.400 Y CD3EAP n/a
30 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3779 3UTR 100% 5.625 2.813 Y KLHL30 n/a
31 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 3959 3UTR 100% 4.950 2.475 Y LOC339059 n/a
32 TRCN0000164079 CATTTCTTCCTGGCTCTCTAT pLKO.1 1212 CDS 100% 4.950 2.475 Y SPDYE8P n/a
33 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 3646 3UTR 100% 2.640 1.320 Y LINC01098 n/a
34 TRCN0000172742 GAGACAGAGTCTTGCTCTGTT pLKO.1 3540 3UTR 100% 0.495 0.248 Y C11orf44 n/a
35 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3779 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012223.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13699 pDONR223 100% 64% 63.9% None 1_432del;860C>G n/a
2 ccsbBroad304_13699 pLX_304 0% 64% 63.9% V5 1_432del;860C>G n/a
3 TRCN0000491865 TCAAGTGTCGATCAACATATTAAG pLX_317 45.6% 64% 63.9% V5 1_432del;860C>G n/a
4 ccsbBroadEn_13656 pDONR223 100% 61% 55.9% None (many diffs) n/a
5 ccsbBroad304_13656 pLX_304 0% 61% 55.9% V5 (many diffs) n/a
6 TRCN0000475668 ACATTGGCACGGGTCGTGATGCCT pLX_317 3.7% 61% 55.9% V5 (many diffs) n/a
7 ccsbBroadEn_13698 pDONR223 100% 50.2% 48% None (many diffs) n/a
8 ccsbBroad304_13698 pLX_304 0% 50.2% 48% V5 (many diffs) n/a
9 TRCN0000479788 CGCTCTCGGCAACTTCTTGCATGC pLX_317 57.1% 50.2% 48% V5 (many diffs) n/a
10 ccsbBroadEn_05577 pDONR223 100% 50.2% 41.7% None (many diffs) n/a
11 ccsbBroad304_05577 pLX_304 0% 50.2% 41.7% V5 (many diffs) n/a
12 TRCN0000476877 TTTTCCGTTTGTGACACTTGCCTT pLX_317 51.9% 50.2% 41.7% V5 (many diffs) n/a
Download CSV