Transcript: Human XM_017012016.2

PREDICTED: Homo sapiens speedy/RINGO cell cycle regulator family member E1 (SPDYE1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPDYE1 (285955)
Length:
3428
CDS:
188..1009

Additional Resources:

NCBI RefSeq record:
XM_017012016.2
NBCI Gene record:
SPDYE1 (285955)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012016.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421900 CACATACCCTTGGTCCGTAAG pLKO_005 788 CDS 100% 6.000 3.600 N SPDYE1 n/a
2 TRCN0000164754 CCTTCATTTCTTCCTGGCTCT pLKO.1 610 CDS 100% 2.160 1.296 N SPDYE1 n/a
3 TRCN0000163860 CTTGCTATGGTCATAGCGTAT pLKO.1 551 CDS 100% 0.405 0.243 N SPDYE1 n/a
4 TRCN0000256763 CTTGAGGATCCTGTCATTAAA pLKO_005 482 CDS 100% 15.000 7.500 Y SPDYE5 n/a
5 TRCN0000149464 GCTTGAGGATCCTGTCATTAA pLKO.1 481 CDS 100% 13.200 6.600 Y SPDYE7P n/a
6 TRCN0000163014 GCTTGAGGATCCTGTCATTAA pLKO.1 481 CDS 100% 13.200 6.600 Y SPDYE2 n/a
7 TRCN0000337318 TAAGCGTCGGTTCCAGTTATA pLKO_005 730 CDS 100% 13.200 6.600 Y SPDYE6 n/a
8 TRCN0000337263 TGCTTGAGGATCCTGTCATTA pLKO_005 480 CDS 100% 13.200 6.600 Y SPDYE6 n/a
9 TRCN0000256762 AGATAGTCCTGTTCCAGAAAC pLKO_005 864 CDS 100% 10.800 5.400 Y SPDYE5 n/a
10 TRCN0000425369 GGAGCATTTGAAGGCACAATG pLKO_005 1402 3UTR 100% 10.800 5.400 Y SPDYE1 n/a
11 TRCN0000427607 TGAGGGTGTCGGACAAGTATC pLKO_005 528 CDS 100% 10.800 5.400 Y SPDYE1 n/a
12 TRCN0000148587 CAGATAGTCCTGTTCCAGAAA pLKO.1 863 CDS 100% 4.950 2.475 Y SPDYE7P n/a
13 TRCN0000129780 CAGCAGGAACTTTATTCCAAT pLKO.1 1085 3UTR 100% 4.950 2.475 Y SPDYE7P n/a
14 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 3276 3UTR 100% 4.950 2.475 Y ORAI2 n/a
15 TRCN0000163830 CCATTCTTGATGGAGCTGAAT pLKO.1 1171 3UTR 100% 4.950 2.475 Y SPDYE1 n/a
16 TRCN0000172267 CTGCTTGAGGATCCTGTCATT pLKO.1 479 CDS 100% 4.950 2.475 Y SPDYE3 n/a
17 TRCN0000162985 GAGACAAGGTTTCACCATGTT pLKO.1 3020 3UTR 100% 4.950 2.475 Y LINC00336 n/a
18 TRCN0000159863 GTTTCTATAAAGCTGTGTGAT pLKO.1 2086 3UTR 100% 4.950 2.475 Y SPDYE1 n/a
19 TRCN0000173018 GTGTTTCCAGTTCCACCCTTT pLKO.1 1283 3UTR 100% 4.050 2.025 Y SPDYE8P n/a
20 TRCN0000163638 GTTCCAGTTATACCGTTCCAT pLKO.1 739 CDS 100% 3.000 1.500 Y SPDYE2 n/a
21 TRCN0000166235 CCACAAGGACTTCAACAGTCA pLKO.1 232 CDS 100% 2.640 1.320 Y SPDYE1 n/a
22 TRCN0000166690 CTCAAGATGAAGCTGAAGCGA pLKO.1 410 CDS 100% 0.750 0.375 Y SPDYE2 n/a
23 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3093 3UTR 100% 5.625 2.813 Y KLHL30 n/a
24 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 3273 3UTR 100% 4.950 2.475 Y LOC339059 n/a
25 TRCN0000164079 CATTTCTTCCTGGCTCTCTAT pLKO.1 614 CDS 100% 4.950 2.475 Y SPDYE8P n/a
26 TRCN0000162782 CTCAAGATGAAGCTGAAGCAA pLKO.1 410 CDS 100% 3.000 1.500 Y SPDYE1 n/a
27 TRCN0000172742 GAGACAGAGTCTTGCTCTGTT pLKO.1 2854 3UTR 100% 0.495 0.248 Y C11orf44 n/a
28 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3093 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012016.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13699 pDONR223 100% 75.9% 74.2% None (many diffs) n/a
2 ccsbBroad304_13699 pLX_304 0% 75.9% 74.2% V5 (many diffs) n/a
3 TRCN0000491865 TCAAGTGTCGATCAACATATTAAG pLX_317 45.6% 75.9% 74.2% V5 (many diffs) n/a
4 ccsbBroadEn_13698 pDONR223 100% 73.9% 71.5% None (many diffs) n/a
5 ccsbBroad304_13698 pLX_304 0% 73.9% 71.5% V5 (many diffs) n/a
6 TRCN0000479788 CGCTCTCGGCAACTTCTTGCATGC pLX_317 57.1% 73.9% 71.5% V5 (many diffs) n/a
7 ccsbBroadEn_13656 pDONR223 100% 73.6% 64.1% None (many diffs) n/a
8 ccsbBroad304_13656 pLX_304 0% 73.6% 64.1% V5 (many diffs) n/a
9 TRCN0000475668 ACATTGGCACGGGTCGTGATGCCT pLX_317 3.7% 73.6% 64.1% V5 (many diffs) n/a
Download CSV