Transcript: Human XM_017012887.2

PREDICTED: Homo sapiens speedy/RINGO cell cycle regulator family member E16 (SPDYE16), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPDYE16 (102723555)
Length:
1717
CDS:
276..1214

Additional Resources:

NCBI RefSeq record:
XM_017012887.2
NBCI Gene record:
SPDYE16 (102723555)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012887.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000256763 CTTGAGGATCCTGTCATTAAA pLKO_005 762 CDS 100% 15.000 7.500 Y SPDYE5 n/a
2 TRCN0000161349 GCAATACCAACGCATTCATTT pLKO.1 878 CDS 100% 13.200 6.600 Y SPDYE2 n/a
3 TRCN0000149464 GCTTGAGGATCCTGTCATTAA pLKO.1 761 CDS 100% 13.200 6.600 Y SPDYE7P n/a
4 TRCN0000163014 GCTTGAGGATCCTGTCATTAA pLKO.1 761 CDS 100% 13.200 6.600 Y SPDYE2 n/a
5 TRCN0000337263 TGCTTGAGGATCCTGTCATTA pLKO_005 760 CDS 100% 13.200 6.600 Y SPDYE6 n/a
6 TRCN0000256760 ATCTCCTGGCTATGGTCATAG pLKO_005 826 CDS 100% 10.800 5.400 Y SPDYE5 n/a
7 TRCN0000337326 CAATACCAACGCATTCATTTC pLKO_005 879 CDS 100% 10.800 5.400 Y SPDYE6 n/a
8 TRCN0000425369 GGAGCATTTGAAGGCACAATG pLKO_005 1606 3UTR 100% 10.800 5.400 Y SPDYE1 n/a
9 TRCN0000427607 TGAGGGTGTCGGACAAGTATC pLKO_005 808 CDS 100% 10.800 5.400 Y SPDYE1 n/a
10 TRCN0000129780 CAGCAGGAACTTTATTCCAAT pLKO.1 1290 3UTR 100% 4.950 2.475 Y SPDYE7P n/a
11 TRCN0000163830 CCATTCTTGATGGAGCTGAAT pLKO.1 1376 3UTR 100% 4.950 2.475 Y SPDYE1 n/a
12 TRCN0000172267 CTGCTTGAGGATCCTGTCATT pLKO.1 759 CDS 100% 4.950 2.475 Y SPDYE3 n/a
13 TRCN0000173018 GTGTTTCCAGTTCCACCCTTT pLKO.1 1488 3UTR 100% 4.050 2.025 Y SPDYE8P n/a
14 TRCN0000162782 CTCAAGATGAAGCTGAAGCAA pLKO.1 459 CDS 100% 3.000 1.500 Y SPDYE1 n/a
15 TRCN0000130862 GTTCCAGTTATGCCGTTGCAT pLKO.1 1019 CDS 100% 3.000 1.500 Y SPDYE7P n/a
16 TRCN0000148971 GTTCCAGTTCTTCTGTTCCAT pLKO.1 1094 CDS 100% 3.000 1.500 Y SPDYE7P n/a
17 TRCN0000166235 CCACAAGGACTTCAACAGTCA pLKO.1 509 CDS 100% 2.640 1.320 Y SPDYE1 n/a
18 TRCN0000146503 CTTCTACTTCCTGTATGGGAA pLKO.1 962 CDS 100% 2.640 1.320 Y SPDYE7P n/a
19 TRCN0000148586 CATTCATTTCTTCCTGGCTCT pLKO.1 890 CDS 100% 2.160 1.080 Y SPDYE7P n/a
20 TRCN0000166690 CTCAAGATGAAGCTGAAGCGA pLKO.1 690 CDS 100% 0.750 0.375 Y SPDYE2 n/a
21 TRCN0000166602 CTGGCTATGGTCATAGCGTAT pLKO.1 831 CDS 100% 0.405 0.203 Y SPDYE2 n/a
22 TRCN0000164079 CATTTCTTCCTGGCTCTCTAT pLKO.1 894 CDS 100% 4.950 2.475 Y SPDYE8P n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012887.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13656 pDONR223 100% 73.7% 61.8% None (many diffs) n/a
2 ccsbBroad304_13656 pLX_304 0% 73.7% 61.8% V5 (many diffs) n/a
3 TRCN0000475668 ACATTGGCACGGGTCGTGATGCCT pLX_317 3.7% 73.7% 61.8% V5 (many diffs) n/a
4 ccsbBroadEn_13698 pDONR223 100% 65.4% 63.1% None (many diffs) n/a
5 ccsbBroad304_13698 pLX_304 0% 65.4% 63.1% V5 (many diffs) n/a
6 TRCN0000479788 CGCTCTCGGCAACTTCTTGCATGC pLX_317 57.1% 65.4% 63.1% V5 (many diffs) n/a
7 ccsbBroadEn_13699 pDONR223 100% 55.5% 52.4% None (many diffs) n/a
8 ccsbBroad304_13699 pLX_304 0% 55.5% 52.4% V5 (many diffs) n/a
9 TRCN0000491865 TCAAGTGTCGATCAACATATTAAG pLX_317 45.6% 55.5% 52.4% V5 (many diffs) n/a
Download CSV