Transcript: Mouse XM_006499735.3

PREDICTED: Mus musculus t-complex 11 like 1 (Tcp11l1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tcp11l1 (320554)
Length:
5553
CDS:
257..1561

Additional Resources:

NCBI RefSeq record:
XM_006499735.3
NBCI Gene record:
Tcp11l1 (320554)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006499735.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000200624 CCTGGTCAACTATAACAAGAT pLKO.1 1486 CDS 100% 4.950 6.930 N Tcp11l1 n/a
2 TRCN0000191863 GCCCATGAAATTGTAGTAACT pLKO.1 266 CDS 100% 4.950 3.960 N Tcp11l1 n/a
3 TRCN0000424574 GCCTCTCTTCAGGGCAATATT pLKO_005 658 CDS 100% 15.000 10.500 N Tcp11l1 n/a
4 TRCN0000191465 CTAGACTAAGAAACCAGATAA pLKO.1 480 CDS 100% 13.200 9.240 N Tcp11l1 n/a
5 TRCN0000200849 GAGATCAAAGAGACTCTGTTA pLKO.1 437 CDS 100% 4.950 3.465 N Tcp11l1 n/a
6 TRCN0000190826 GCCTACCTGAAGCTTCTGAAA pLKO.1 953 CDS 100% 4.950 3.465 N Tcp11l1 n/a
7 TRCN0000130627 CCTACTACGATGCAATCCTGA pLKO.1 1518 CDS 100% 2.640 3.696 N TCP11L1 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2385 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006499735.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08528 pDONR223 100% 73.8% 74.6% None (many diffs) n/a
2 ccsbBroad304_08528 pLX_304 0% 73.8% 74.6% V5 (many diffs) n/a
3 TRCN0000475928 ACATGGGCCGCACTATCAACGCCA pLX_317 17.2% 73.8% 74.6% V5 (many diffs) n/a
Download CSV