Construct: ORF TRCN0000476241
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010276.1_s317c1
- Derived from:
- ccsbBroadEn_01736
- DNA Barcode:
- GCGGACTCAGCGCCTGTAGTGTGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- UBE2D2 (7322)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476241
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 7322 | UBE2D2 | ubiquitin conjugating enzym... | NM_003339.3 | 100% | 100% | |
| 2 | human | 7323 | UBE2D3 | ubiquitin conjugating enzym... | NM_003340.6 | 86.6% | 97.2% | (many diffs) |
| 3 | human | 7323 | UBE2D3 | ubiquitin conjugating enzym... | NM_181886.3 | 86.6% | 97.2% | (many diffs) |
| 4 | human | 7323 | UBE2D3 | ubiquitin conjugating enzym... | NM_181887.2 | 86.6% | 97.2% | (many diffs) |
| 5 | human | 7323 | UBE2D3 | ubiquitin conjugating enzym... | NM_181888.3 | 86.6% | 97.2% | (many diffs) |
| 6 | human | 7323 | UBE2D3 | ubiquitin conjugating enzym... | NM_181889.2 | 86.6% | 97.2% | (many diffs) |
| 7 | human | 7323 | UBE2D3 | ubiquitin conjugating enzym... | NM_181890.2 | 86.6% | 97.2% | (many diffs) |
| 8 | human | 7323 | UBE2D3 | ubiquitin conjugating enzym... | NM_181891.3 | 86.6% | 97.2% | (many diffs) |
| 9 | human | 7323 | UBE2D3 | ubiquitin conjugating enzym... | XM_024454202.1 | 86.6% | 97.2% | (many diffs) |
| 10 | human | 7323 | UBE2D3 | ubiquitin conjugating enzym... | NM_181893.2 | 84.8% | 92.6% | (many diffs) |
| 11 | human | 7323 | UBE2D3 | ubiquitin conjugating enzym... | NM_181892.3 | 83.7% | 95.9% | (many diffs) |
| 12 | human | 7322 | UBE2D2 | ubiquitin conjugating enzym... | XM_017009820.1 | 81.9% | 78.6% | (many diffs) |
| 13 | human | 7322 | UBE2D2 | ubiquitin conjugating enzym... | NM_181838.1 | 80.2% | 80.2% | 0_1ins87 |
| 14 | human | 51619 | UBE2D4 | ubiquitin conjugating enzym... | NM_015983.4 | 78% | 93.1% | (many diffs) |
| 15 | human | 7323 | UBE2D3 | ubiquitin conjugating enzym... | NM_001300795.1 | 70.7% | 78.9% | (many diffs) |
| 16 | human | 7323 | UBE2D3 | ubiquitin conjugating enzym... | XM_017008584.2 | 70.7% | 78.9% | (many diffs) |
| 17 | human | 51619 | UBE2D4 | ubiquitin conjugating enzym... | XM_024446796.1 | 58.7% | 70.7% | (many diffs) |
| 18 | human | 51619 | UBE2D4 | ubiquitin conjugating enzym... | XM_011515422.3 | 58% | 68.7% | (many diffs) |
| 19 | mouse | 56550 | Ube2d2a | ubiquitin-conjugating enzym... | NM_019912.2 | 97.2% | 100% | (many diffs) |
| 20 | mouse | 73318 | Ube2d2b | ubiquitin-conjugating enzym... | NM_001276397.1 | 92.5% | 92.5% | (many diffs) |
| 21 | mouse | 66105 | Ube2d3 | ubiquitin-conjugating enzym... | NM_025356.4 | 87.3% | 97.2% | (many diffs) |
| 22 | mouse | 66105 | Ube2d3 | ubiquitin-conjugating enzym... | XM_006501873.2 | 87.3% | 97.2% | (many diffs) |
| 23 | mouse | 66105 | Ube2d3 | ubiquitin-conjugating enzym... | XM_006501874.2 | 87.3% | 97.2% | (many diffs) |
| 24 | mouse | 66105 | Ube2d3 | ubiquitin-conjugating enzym... | XM_006501875.2 | 87.3% | 97.2% | (many diffs) |
| 25 | mouse | 56550 | Ube2d2a | ubiquitin-conjugating enzym... | XM_006526120.2 | 78.6% | 80.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 510
- ORF length:
- 441
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggctctgaag agaatccaca aggaattgaa tgatctggca cgggaccctc 121 cagcacagtg ttcagcaggt cctgttggag atgatatgtt ccattggcaa gctacaataa 181 tggggccaaa tgacagtccc tatcagggtg gagtattttt cttgacaatt catttcccaa 241 cagattaccc cttcaaacca cctaaggttg catttacaac aagaatttat catccaaata 301 ttaacagtaa tggcagcatt tgtcttgata ttcTACGATC ACAGTGGTCT CCAGCACTAA 361 CTATTTCAAA AGTACTCTTG TCCATCTGTT CTCTGTTGTG TGATCCCAAT CCAGATGATC 421 CTTTAGTGCC TGAGATTGCT CGGATCTACA AAACAGATAG AGAAAAGTAC AACAGAATAG 481 CTCGGGAATG GACTCAGAAG TATGCGATGT TGCCAACTTT CTTGTACAAA GTGGTTGATA 541 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTTTAT 601 ATATCTTGTG GAAAGGACGA GCGGACTCAG CGCCTGTAGT GTGAACGCGT TAAGTCgaca 661 atcaacctct ggattacaaa atttgtgaaa gatt