Transcript: Mouse XM_006501873.2

PREDICTED: Mus musculus ubiquitin-conjugating enzyme E2D 3 (Ube2d3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ube2d3 (66105)
Length:
2616
CDS:
346..789

Additional Resources:

NCBI RefSeq record:
XM_006501873.2
NBCI Gene record:
Ube2d3 (66105)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501873.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038791 GCCACAATTATGGGACCTAAT pLKO.1 448 CDS 100% 10.800 15.120 N UBE2D3 n/a
2 TRCN0000416003 GTGGCTGGAGAATTGGTATTG pLKO_005 1280 3UTR 100% 10.800 8.640 N UBE2D3 n/a
3 TRCN0000311094 TCATTGGCAAGCCACAATTAT pLKO_005 438 CDS 100% 15.000 10.500 N Ube2d3 n/a
4 TRCN0000417337 AGTCAGAATAACCTGCATTAT pLKO_005 801 3UTR 100% 13.200 9.240 N UBE2D3 n/a
5 TRCN0000304670 CAGAGATTGCACGGATCTATA pLKO_005 707 CDS 100% 13.200 9.240 N Ube2d3 n/a
6 TRCN0000038789 CCTGCATTATAGCTGGAATAA pLKO.1 812 3UTR 100% 13.200 9.240 N UBE2D3 n/a
7 TRCN0000304617 GATATACTTTATGCTCATAAC pLKO_005 1255 3UTR 100% 10.800 7.560 N Ube2d3 n/a
8 TRCN0000436303 TCACTGCTATGTGATCCAAAC pLKO_005 667 CDS 100% 6.000 4.200 N UBE2D3 n/a
9 TRCN0000038792 CCAGAGATTGCACGGATCTAT pLKO.1 706 CDS 100% 5.625 3.938 N UBE2D3 n/a
10 TRCN0000039472 CTCCTGCTTTAACTATTTCTA pLKO.1 626 CDS 100% 5.625 3.938 N Ube2d3 n/a
11 TRCN0000431008 GATAAGTACAACAGAATATCT pLKO_005 739 CDS 100% 5.625 3.938 N UBE2D3 n/a
12 TRCN0000039473 CAGAGATAAGTACAACAGAAT pLKO.1 735 CDS 100% 4.950 3.465 N Ube2d3 n/a
13 TRCN0000302198 CAGAGATAAGTACAACAGAAT pLKO_005 735 CDS 100% 4.950 3.465 N Ube2d3 n/a
14 TRCN0000039470 GCCCATATCAAGGTGGTGTAT pLKO.1 473 CDS 100% 4.950 3.465 N Ube2d3 n/a
15 TRCN0000039469 ACAACAGAATATCTCGGGAAT pLKO.1 746 CDS 100% 4.050 2.430 N Ube2d3 n/a
16 TRCN0000412639 ATATCTCGGGAATGGACTCAG pLKO_005 754 CDS 100% 4.050 2.430 N UBE2D3 n/a
17 TRCN0000304671 GGCAGCATTTGTCTTGATATT pLKO_005 589 CDS 100% 13.200 6.600 Y Ube2d3 n/a
18 TRCN0000039471 CCCTTCAAACCACCTAAGGTT pLKO.1 526 CDS 100% 3.000 1.500 Y Ube2d3 n/a
19 TRCN0000423099 GCCATGTGATGCTACCTTAAA pLKO_005 781 CDS 100% 13.200 9.240 N UBE2D3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501873.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07114 pDONR223 100% 98.1% 99.3% None (many diffs) n/a
2 ccsbBroad304_07114 pLX_304 0% 98.1% 99.3% V5 (many diffs) n/a
3 TRCN0000467586 GAATGGAAAAAATCAAATTTAACA pLX_317 77% 98.1% 99.3% V5 (many diffs) n/a
4 ccsbBroadEn_13977 pDONR223 100% 97.7% None (many diffs) n/a
5 ccsbBroad304_13977 pLX_304 0% 97.7% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000475475 CGCGAGGCGGATAATTATTTAATT pLX_317 72.3% 97.7% V5 (not translated due to prior stop codon) (many diffs) n/a
7 ccsbBroadEn_01736 pDONR223 100% 87.3% 97.2% None (many diffs) n/a
8 ccsbBroad304_01736 pLX_304 0% 87.3% 97.2% V5 (many diffs) n/a
9 TRCN0000476241 GCGGACTCAGCGCCTGTAGTGTGA pLX_317 40.3% 87.3% 97.2% V5 (many diffs) n/a
Download CSV