Transcript: Human NM_181888.3

Homo sapiens ubiquitin conjugating enzyme E2 D3 (UBE2D3), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
UBE2D3 (7323)
Length:
3833
CDS:
343..786

Additional Resources:

NCBI RefSeq record:
NM_181888.3
NBCI Gene record:
UBE2D3 (7323)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_181888.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038793 CCCATATCAAGGCGGTGTATT pLKO.1 471 CDS 100% 13.200 18.480 N UBE2D3 n/a
2 TRCN0000038791 GCCACAATTATGGGACCTAAT pLKO.1 445 CDS 100% 10.800 15.120 N UBE2D3 n/a
3 TRCN0000311094 TCATTGGCAAGCCACAATTAT pLKO_005 435 CDS 100% 15.000 10.500 N Ube2d3 n/a
4 TRCN0000417337 AGTCAGAATAACCTGCATTAT pLKO_005 798 3UTR 100% 13.200 9.240 N UBE2D3 n/a
5 TRCN0000304670 CAGAGATTGCACGGATCTATA pLKO_005 704 CDS 100% 13.200 9.240 N Ube2d3 n/a
6 TRCN0000038789 CCTGCATTATAGCTGGAATAA pLKO.1 809 3UTR 100% 13.200 9.240 N UBE2D3 n/a
7 TRCN0000423099 GCCATGTGATGCTACCTTAAA pLKO_005 778 CDS 100% 13.200 9.240 N UBE2D3 n/a
8 TRCN0000416003 GTGGCTGGAGAATTGGTATTG pLKO_005 1280 3UTR 100% 10.800 7.560 N UBE2D3 n/a
9 TRCN0000038792 CCAGAGATTGCACGGATCTAT pLKO.1 703 CDS 100% 5.625 3.938 N UBE2D3 n/a
10 TRCN0000431008 GATAAGTACAACAGAATATCT pLKO_005 736 CDS 100% 5.625 3.938 N UBE2D3 n/a
11 TRCN0000038790 GCCTGCTTTAACAATTTCTAA pLKO.1 624 CDS 100% 5.625 3.938 N UBE2D3 n/a
12 TRCN0000436303 TCACTGCTATGTGATCCAAAC pLKO_005 664 CDS 100% 6.000 3.600 N UBE2D3 n/a
13 TRCN0000039473 CAGAGATAAGTACAACAGAAT pLKO.1 732 CDS 100% 4.950 2.970 N Ube2d3 n/a
14 TRCN0000302198 CAGAGATAAGTACAACAGAAT pLKO_005 732 CDS 100% 4.950 2.970 N Ube2d3 n/a
15 TRCN0000039469 ACAACAGAATATCTCGGGAAT pLKO.1 743 CDS 100% 4.050 2.430 N Ube2d3 n/a
16 TRCN0000412639 ATATCTCGGGAATGGACTCAG pLKO_005 751 CDS 100% 4.050 2.430 N UBE2D3 n/a
17 TRCN0000039471 CCCTTCAAACCACCTAAGGTT pLKO.1 523 CDS 100% 3.000 1.500 Y Ube2d3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181888.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07114 pDONR223 100% 99.7% 99.3% None 7C>G n/a
2 ccsbBroad304_07114 pLX_304 0% 99.7% 99.3% V5 7C>G n/a
3 TRCN0000467586 GAATGGAAAAAATCAAATTTAACA pLX_317 77% 99.7% 99.3% V5 7C>G n/a
4 ccsbBroadEn_13977 pDONR223 100% 99.3% None 7delC;357A>G;367A>C n/a
5 ccsbBroad304_13977 pLX_304 0% 99.3% V5 (not translated due to prior stop codon) 7delC;357A>G;367A>C n/a
6 TRCN0000475475 CGCGAGGCGGATAATTATTTAATT pLX_317 72.3% 99.3% V5 (not translated due to prior stop codon) 7delC;357A>G;367A>C n/a
7 ccsbBroadEn_01736 pDONR223 100% 86.6% 97.2% None (many diffs) n/a
8 ccsbBroad304_01736 pLX_304 0% 86.6% 97.2% V5 (many diffs) n/a
9 TRCN0000476241 GCGGACTCAGCGCCTGTAGTGTGA pLX_317 40.3% 86.6% 97.2% V5 (many diffs) n/a
Download CSV