Transcript: Human XM_017009820.1

PREDICTED: Homo sapiens ubiquitin conjugating enzyme E2 D2 (UBE2D2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UBE2D2 (7322)
Length:
2332
CDS:
920..1441

Additional Resources:

NCBI RefSeq record:
XM_017009820.1
NBCI Gene record:
UBE2D2 (7322)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009820.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430952 GAAGTATGCGATGTAATTAAA pLKO_005 1426 CDS 100% 15.000 10.500 N Ube2d2a n/a
2 TRCN0000272127 CCCTATCAGGGTGGAGTATTT pLKO_005 1127 CDS 100% 13.200 9.240 N Gm9762 n/a
3 TRCN0000314554 CCCTATCAGGGTGGAGTATTT pLKO_005 1127 CDS 100% 13.200 9.240 N UBE2D2 n/a
4 TRCN0000272072 CTCAGAAGTATGCGATGTAAT pLKO_005 1422 CDS 100% 13.200 9.240 N Gm9762 n/a
5 TRCN0000272070 TGGTCTCCAGCACTAACTATT pLKO_005 1274 CDS 100% 13.200 9.240 N Gm9762 n/a
6 TRCN0000431340 TGTACTTCTGTACCAACATTG pLKO_005 1623 3UTR 100% 10.800 7.560 N Ube2d2a n/a
7 TRCN0000003387 CTCCAGCACTAACTATTTCAA pLKO.1 1278 CDS 100% 5.625 3.938 N UBE2D2 n/a
8 TRCN0000003389 CCTGTTGGAGATGATATGTTC pLKO.1 1070 CDS 100% 4.950 3.465 N UBE2D2 n/a
9 TRCN0000003390 TGTCCATCTGTTCTCTGTTGT pLKO.1 1308 CDS 100% 4.950 3.465 N UBE2D2 n/a
10 TRCN0000350299 TGTCCATCTGTTCTCTGTTGT pLKO_005 1308 CDS 100% 4.950 3.465 N UBE2D2 n/a
11 TRCN0000003386 GTTCTCTGTTGTGTGATCCCA pLKO.1 1317 CDS 100% 0.750 0.525 N UBE2D2 n/a
12 TRCN0000314505 GTTCTCTGTTGTGTGATCCCA pLKO_005 1317 CDS 100% 0.750 0.525 N UBE2D2 n/a
13 TRCN0000304671 GGCAGCATTTGTCTTGATATT pLKO_005 1241 CDS 100% 13.200 7.920 N Ube2d3 n/a
14 TRCN0000037316 CCCAATCCAGATGATCCTTTA pLKO.1 1334 CDS 100% 10.800 6.480 N Ube2d2a n/a
15 TRCN0000039471 CCCTTCAAACCACCTAAGGTT pLKO.1 1178 CDS 100% 3.000 1.500 Y Ube2d3 n/a
16 TRCN0000037318 CCTGTTGGAGATGATATGTTT pLKO.1 1070 CDS 100% 5.625 3.938 N Ube2d2a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009820.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01736 pDONR223 100% 81.9% 78.6% None (many diffs) n/a
2 ccsbBroad304_01736 pLX_304 0% 81.9% 78.6% V5 (many diffs) n/a
3 TRCN0000476241 GCGGACTCAGCGCCTGTAGTGTGA pLX_317 40.3% 81.9% 78.6% V5 (many diffs) n/a
4 ccsbBroadEn_07114 pDONR223 100% 73.7% 76.9% None (many diffs) n/a
5 ccsbBroad304_07114 pLX_304 0% 73.7% 76.9% V5 (many diffs) n/a
6 TRCN0000467586 GAATGGAAAAAATCAAATTTAACA pLX_317 77% 73.7% 76.9% V5 (many diffs) n/a
7 ccsbBroadEn_13977 pDONR223 100% 73.4% None (many diffs) n/a
8 ccsbBroad304_13977 pLX_304 0% 73.4% V5 (not translated due to prior stop codon) (many diffs) n/a
9 TRCN0000475475 CGCGAGGCGGATAATTATTTAATT pLX_317 72.3% 73.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV