Transcript: Mouse NM_019912.2

Mus musculus ubiquitin-conjugating enzyme E2D 2A (Ube2d2a), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Ube2d2a (56550)
Length:
2483
CDS:
431..874

Additional Resources:

NCBI RefSeq record:
NM_019912.2
NBCI Gene record:
Ube2d2a (56550)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019912.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430952 GAAGTATGCGATGTAATTAAA pLKO_005 859 CDS 100% 15.000 12.000 N Ube2d2a n/a
2 TRCN0000414451 ACGTGAAGCTGTTTCTATATT pLKO_005 1307 3UTR 100% 15.000 10.500 N Ube2d2a n/a
3 TRCN0000037317 TCATTGGCAGGCTACAATAAT pLKO.1 523 CDS 100% 15.000 10.500 N Ube2d2a n/a
4 TRCN0000272127 CCCTATCAGGGTGGAGTATTT pLKO_005 560 CDS 100% 13.200 9.240 N Gm9762 n/a
5 TRCN0000314554 CCCTATCAGGGTGGAGTATTT pLKO_005 560 CDS 100% 13.200 9.240 N UBE2D2 n/a
6 TRCN0000272072 CTCAGAAGTATGCGATGTAAT pLKO_005 855 CDS 100% 13.200 9.240 N Gm9762 n/a
7 TRCN0000434098 TAACCTAGGTGTGAGACTAAA pLKO_005 1125 3UTR 100% 13.200 9.240 N Ube2d2a n/a
8 TRCN0000272071 TTCATTGGCAGGCTACAATAA pLKO_005 522 CDS 100% 13.200 9.240 N Gm9762 n/a
9 TRCN0000285699 CCATAATCTTTGGTTTGTATG pLKO_005 1526 3UTR 100% 10.800 7.560 N Gm9762 n/a
10 TRCN0000037318 CCTGTTGGAGATGATATGTTT pLKO.1 503 CDS 100% 5.625 3.938 N Ube2d2a n/a
11 TRCN0000037314 CCTGGGAAACATGAGCACAAT pLKO.1 2136 3UTR 100% 4.950 3.465 N Ube2d2a n/a
12 TRCN0000037316 CCCAATCCAGATGATCCTTTA pLKO.1 767 CDS 100% 10.800 6.480 N Ube2d2a n/a
13 TRCN0000431340 TGTACTTCTGTACCAACATTG pLKO_005 1058 3UTR 100% 10.800 6.480 N Ube2d2a n/a
14 TRCN0000037315 CGCCTAAGGTTGCATTTACAA pLKO.1 621 CDS 100% 5.625 3.375 N Ube2d2a n/a
15 TRCN0000003390 TGTCCATCTGTTCTCTGTTGT pLKO.1 741 CDS 100% 4.950 2.970 N UBE2D2 n/a
16 TRCN0000350299 TGTCCATCTGTTCTCTGTTGT pLKO_005 741 CDS 100% 4.950 2.970 N UBE2D2 n/a
17 TRCN0000003386 GTTCTCTGTTGTGTGATCCCA pLKO.1 750 CDS 100% 0.750 0.450 N UBE2D2 n/a
18 TRCN0000314505 GTTCTCTGTTGTGTGATCCCA pLKO_005 750 CDS 100% 0.750 0.450 N UBE2D2 n/a
19 TRCN0000304671 GGCAGCATTTGTCTTGATATT pLKO_005 674 CDS 100% 13.200 6.600 Y Ube2d3 n/a
20 TRCN0000272070 TGGTCTCCAGCACTAACTATT pLKO_005 707 CDS 100% 13.200 6.600 Y Gm9762 n/a
21 TRCN0000003387 CTCCAGCACTAACTATTTCAA pLKO.1 711 CDS 100% 5.625 2.813 Y UBE2D2 n/a
22 TRCN0000003389 CCTGTTGGAGATGATATGTTC pLKO.1 503 CDS 100% 4.950 3.465 N UBE2D2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019912.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01736 pDONR223 100% 97.2% 100% None (many diffs) n/a
2 ccsbBroad304_01736 pLX_304 0% 97.2% 100% V5 (many diffs) n/a
3 TRCN0000476241 GCGGACTCAGCGCCTGTAGTGTGA pLX_317 40.3% 97.2% 100% V5 (many diffs) n/a
4 ccsbBroadEn_07114 pDONR223 100% 85.4% 96.5% None (many diffs) n/a
5 ccsbBroad304_07114 pLX_304 0% 85.4% 96.5% V5 (many diffs) n/a
6 TRCN0000467586 GAATGGAAAAAATCAAATTTAACA pLX_317 77% 85.4% 96.5% V5 (many diffs) n/a
7 ccsbBroadEn_13977 pDONR223 100% 85% None (many diffs) n/a
8 ccsbBroad304_13977 pLX_304 0% 85% V5 (not translated due to prior stop codon) (many diffs) n/a
9 TRCN0000475475 CGCGAGGCGGATAATTATTTAATT pLX_317 72.3% 85% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV