Construct: ORF TRCN0000476847
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012312.1_s317c1
- Derived from:
- ccsbBroadEn_00923
- DNA Barcode:
- GTCAACGACCTAAGGAACTCGTGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- LAIR1 (3903)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476847
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3903 | LAIR1 | leukocyte associated immuno... | NM_002287.6 | 99.5% | 98.6% | (many diffs) |
| 2 | human | 3903 | LAIR1 | leukocyte associated immuno... | NM_001289025.3 | 99.1% | 98.2% | (many diffs) |
| 3 | human | 3903 | LAIR1 | leukocyte associated immuno... | NM_001289026.2 | 94.3% | 94.4% | (many diffs) |
| 4 | human | 3903 | LAIR1 | leukocyte associated immuno... | NM_021706.5 | 93.7% | 93% | (many diffs) |
| 5 | human | 3903 | LAIR1 | leukocyte associated immuno... | NM_001289023.3 | 93.3% | 92.6% | (many diffs) |
| 6 | human | 3903 | LAIR1 | leukocyte associated immuno... | NM_001289027.2 | 91.2% | 90.5% | (many diffs) |
| 7 | human | 3903 | LAIR1 | leukocyte associated immuno... | XM_017026803.2 | 58.2% | 46.1% | (many diffs) |
| 8 | human | 3904 | LAIR2 | leukocyte associated immuno... | NM_002288.6 | 46.7% | 41.1% | (many diffs) |
| 9 | human | 3904 | LAIR2 | leukocyte associated immuno... | XM_011526961.2 | 42.9% | 36.9% | (many diffs) |
| 10 | human | 3904 | LAIR2 | leukocyte associated immuno... | NM_021270.5 | 41.8% | 34.9% | (many diffs) |
| 11 | human | 3903 | LAIR1 | leukocyte associated immuno... | NR_110280.3 | 15.8% | (many diffs) | |
| 12 | human | 3903 | LAIR1 | leukocyte associated immuno... | NR_110279.3 | 15.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 927
- ORF length:
- 861
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc tccccacccc accgccctcc tgggcctagt gctctgcctg gcccagacca 121 tccacacgca ggaggaagat ctgcccagac cctccatctc ggctgagcca ggcaccgtga 181 tccccctggg gagccatgtg actttcgtgt gccggggccc ggttggggtt caaacattcc 241 gcctggagag ggagagtaga tccacataca atgatactga agatgtgtct caagctagtc 301 catctgagtc agaggccaga ttccgcattg actcagtaag tgaaggaaat gccgggcctt 361 atcgctgcat ctattataag ccccctaaat ggtctgagca gagtgactac ctggagctgc 421 tggtgaaaga aacctctgga ggcccggact ccccggacac agagcccggc tcctcagctg 481 gacccacgca gaggccgtcg gacaacagtc acaatgagca tgcacctgct tcccaaggcc 541 tgaaagctga gcatctgtat attctcatcg gggtctcagt ggtcttcctc ttctgtctcc 601 TCCTCCTGGT CCTCTTCTGC CTCCATCGCC AGAATCAGAT AAAGCAGGGG CCCCCCAGAA 661 GCAAGGACGA GGAGCAGAAG CCACAGCAGA GGCCTGACCT GGCTGTTGAT GTTCTAGAGA 721 GGACAGCAGA CAAGGCCACA GTCAATGGAC TTCCTGAGAA GGACAGAGAG ACGGACACCT 781 CGGCCCTGGC TGCAGGGAGT TCCCAGGAGG TGACGTATGC TCAGCTGGAC CACTGGGCCC 841 TCACACAGAG GACAGCCCGG GCTGTGTCCC CACAGTCCAC AAAGCCCATG GCCGAGTCCA 901 TCACGTATGC AGCCGTTGCC AGACACTGCC CAACTTTCTT GTACAAAGTG GTTGATATCG 961 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1021 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GAGTCAACGA 1081 CCTAAGGAAC TCGTGCACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1141 aagatt