Transcript: Human NM_001289025.3

Homo sapiens leukocyte associated immunoglobulin like receptor 1 (LAIR1), transcript variant e, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
LAIR1 (3903)
Length:
4872
CDS:
128..988

Additional Resources:

NCBI RefSeq record:
NM_001289025.3
NBCI Gene record:
LAIR1 (3903)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001289025.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063589 CCGTCGGACAACAGTCACAAT pLKO.1 554 CDS 100% 4.950 6.930 N LAIR1 n/a
2 TRCN0000063588 CCATCGCCAGAATCAGATAAA pLKO.1 682 CDS 100% 13.200 10.560 N LAIR1 n/a
3 TRCN0000425722 GTGTCTCAAGCTAGTCCATCT pLKO_005 344 CDS 100% 4.050 3.240 N LAIR1 n/a
4 TRCN0000063591 GACCTGGCTGTTGATGTTCTA pLKO.1 755 CDS 100% 4.950 3.465 N LAIR1 n/a
5 TRCN0000063590 TCCACATACAATGATACTGAA pLKO.1 320 CDS 100% 4.950 3.465 N LAIR1 n/a
6 TRCN0000423583 AGCATCTGTATATTCTCATCG pLKO_005 609 CDS 100% 4.050 2.835 N LAIR1 n/a
7 TRCN0000417660 CTAAATGGTCTGAGCAGAGTG pLKO_005 444 CDS 100% 4.050 2.835 N LAIR1 n/a
8 TRCN0000420408 CAGAGACTTTGCTGTAATTAT pLKO_005 1418 3UTR 100% 15.000 9.000 N LAIR1 n/a
9 TRCN0000430210 CCTGAAAGCTGAGCATCTGTA pLKO_005 598 CDS 100% 4.950 2.970 N LAIR1 n/a
10 TRCN0000438239 CAATGAGCATGCACCTGCTTC pLKO_005 571 CDS 100% 4.050 2.430 N LAIR1 n/a
11 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2243 3UTR 100% 4.950 2.475 Y ERAP2 n/a
12 TRCN0000165704 CAATGGCACAATCTTGGCTCA pLKO.1 3132 3UTR 100% 2.160 1.080 Y LOC652276 n/a
13 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2244 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289025.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00923 pDONR223 100% 99.1% 98.2% None (many diffs) n/a
2 ccsbBroad304_00923 pLX_304 0% 99.1% 98.2% V5 (many diffs) n/a
3 TRCN0000476847 GTCAACGACCTAAGGAACTCGTGC pLX_317 38.2% 99.1% 98.2% V5 (many diffs) n/a
4 ccsbBroadEn_00924 pDONR223 100% 46.6% 41.1% None (many diffs) n/a
5 ccsbBroad304_00924 pLX_304 0% 46.6% 41.1% V5 (many diffs) n/a
6 TRCN0000470273 GTCGTTTCGCTCCAATGACACGAT pLX_317 77.5% 46.6% 41.1% V5 (many diffs) n/a
Download CSV