Transcript: Human XM_017026803.2

PREDICTED: Homo sapiens leukocyte associated immunoglobulin like receptor 1 (LAIR1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LAIR1 (3903)
Length:
704
CDS:
128..697

Additional Resources:

NCBI RefSeq record:
XM_017026803.2
NBCI Gene record:
LAIR1 (3903)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017026803.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425722 GTGTCTCAAGCTAGTCCATCT pLKO_005 347 CDS 100% 4.050 3.240 N LAIR1 n/a
2 TRCN0000063590 TCCACATACAATGATACTGAA pLKO.1 323 CDS 100% 4.950 3.465 N LAIR1 n/a
3 TRCN0000417660 CTAAATGGTCTGAGCAGAGTG pLKO_005 447 CDS 100% 4.050 2.835 N LAIR1 n/a
4 TRCN0000060329 CCTCCGGATTTGATGCACCAT pLKO.1 564 CDS 100% 2.640 1.320 Y LAIR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017026803.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00924 pDONR223 100% 74% 67.7% None (many diffs) n/a
2 ccsbBroad304_00924 pLX_304 0% 74% 67.7% V5 (many diffs) n/a
3 TRCN0000470273 GTCGTTTCGCTCCAATGACACGAT pLX_317 77.5% 74% 67.7% V5 (many diffs) n/a
4 ccsbBroadEn_00923 pDONR223 100% 58.2% 46.1% None (many diffs) n/a
5 ccsbBroad304_00923 pLX_304 0% 58.2% 46.1% V5 (many diffs) n/a
6 TRCN0000476847 GTCAACGACCTAAGGAACTCGTGC pLX_317 38.2% 58.2% 46.1% V5 (many diffs) n/a
Download CSV