Transcript: Human NM_002288.6

Homo sapiens leukocyte associated immunoglobulin like receptor 2 (LAIR2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
LAIR2 (3904)
Length:
665
CDS:
89..547

Additional Resources:

NCBI RefSeq record:
NM_002288.6
NBCI Gene record:
LAIR2 (3904)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002288.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000372816 TCGACTTGGTCCATCTGAGTC pLKO_005 313 CDS 100% 4.050 3.240 N LAIR2 n/a
2 TRCN0000060328 GCCAAGTACAAAGATAGTTAT pLKO.1 284 CDS 100% 13.200 9.240 N LAIR2 n/a
3 TRCN0000060330 GATAGAGCCAAGTACAAAGAT pLKO.1 278 CDS 100% 5.625 3.938 N LAIR2 n/a
4 TRCN0000372760 AGTTATAATGTGTTTCGACTT pLKO_005 299 CDS 100% 4.050 2.835 N LAIR2 n/a
5 TRCN0000372815 TGGATGGTCTGAGCACAGTGA pLKO_005 409 CDS 100% 2.640 1.848 N LAIR2 n/a
6 TRCN0000060332 GATTCCACATTGACTCAGTAA pLKO.1 342 CDS 100% 4.950 2.970 N LAIR2 n/a
7 TRCN0000060331 CCCTTCCCAGACCCTCCATCT pLKO.1 162 CDS 100% 0.000 0.000 N LAIR2 n/a
8 TRCN0000060329 CCTCCGGATTTGATGCACCAT pLKO.1 525 CDS 100% 2.640 1.320 Y LAIR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002288.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00924 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00924 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470273 GTCGTTTCGCTCCAATGACACGAT pLX_317 77.5% 100% 100% V5 n/a
4 ccsbBroadEn_00923 pDONR223 100% 46.7% 41.1% None (many diffs) n/a
5 ccsbBroad304_00923 pLX_304 0% 46.7% 41.1% V5 (many diffs) n/a
6 TRCN0000476847 GTCAACGACCTAAGGAACTCGTGC pLX_317 38.2% 46.7% 41.1% V5 (many diffs) n/a
Download CSV