Transcript: Human XM_017012570.2

PREDICTED: Homo sapiens thromboxane A synthase 1 (TBXAS1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TBXAS1 (6916)
Length:
6338
CDS:
165..1520

Additional Resources:

NCBI RefSeq record:
XM_017012570.2
NBCI Gene record:
TBXAS1 (6916)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012570.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435686 GTCGGATGTTTATTGTTATTT pLKO_005 418 CDS 100% 15.000 21.000 N TBXAS1 n/a
2 TRCN0000415143 CCTCATCGCTGGCTATGAAAT pLKO_005 1181 CDS 100% 13.200 18.480 N TBXAS1 n/a
3 TRCN0000045328 CCCAATAAGAACCGAGACGAA pLKO.1 897 CDS 100% 2.640 3.696 N TBXAS1 n/a
4 TRCN0000045332 CGAGACGAACTGAATGGCTTT pLKO.1 909 CDS 100% 4.050 3.240 N TBXAS1 n/a
5 TRCN0000429032 TTATCATTTCCATCCATAATG pLKO_005 855 CDS 100% 13.200 9.240 N TBXAS1 n/a
6 TRCN0000045331 GTTGAGAACTTCAGTAACTTT pLKO.1 468 CDS 100% 5.625 3.938 N TBXAS1 n/a
7 TRCN0000045329 CCAGAGGTGCTACTGCAATTA pLKO.1 701 CDS 100% 13.200 7.920 N TBXAS1 n/a
8 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 6227 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012570.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01649 pDONR223 100% 61.6% 56.4% None (many diffs) n/a
2 ccsbBroad304_01649 pLX_304 0% 61.6% 56.4% V5 (many diffs) n/a
3 TRCN0000478515 TCCGACATCCTCCTGTGCTGAACA pLX_317 25.8% 61.6% 56.4% V5 (many diffs) n/a
Download CSV